Меню Закрыть

Какой витамин способствует росту волос: Какие витамины нужны для волос?

Содержание

Польза витаминов группы В для волос


Красота и здоровье волос зависит не только от ежедневного внешнего ухода, но и от качества питания. Чтобы волосы были крепкими, им необходим богатый рацион веществ.
Особую пользу волосам приносят ниацинамид (витамин PP) и витамины группы В – они жизненно необходимы нашим волосам.

Ниацинамид обладает высокой биологической активностью. Механизм физиологического действия обусловлен способностью расширять мелкие кровеносные сосуды, тем самым улучшать кровоснабжение волосяных луковиц, что благоприятно сказывается на их состоянии и росте волос.

Витамины группы В также отвечают за активный рост и здоровье волос:

Витамин В1 (тиамин) – приводит в норму работу сальных желез кожи головы, полезен при низкой скорости роста волос и себорее.
Витамин В2 (рибофлавин) – активизирует кровообращение, тем самым обеспечивая нормальное снабжение волосяных луковиц кислородом и питательными веществами. При дефиците витамина В2 корни волос становятся жирными, а кончики — сухими.

Витамин В3 (ниацин) – увлажняет корни волос и профилактирует их выпадение.
Витамин В6 (пиридоксин) – предотвращает появление перхоти, зуда кожи головы и сухости волос. При недостатке этого витамина волосы тускнеют, теряют насыщенность цвета и блеск.
Витамин В8 предохраняет волосы от появления ранней седины, помогает сохранять здоровую структуру волос.
Витамин В12 (цианокобаламин) восстанавливает структуру поврежденных волос и в целом положительно влияет на их состояние.

Ниацинамидом богаты такие продукты, как печень, гречневая крупа, желтки яиц, дрожжи.

Источником различных витаминов группы В служат зерновые продукты, отруби, рис, орехи, семечки, грибы, молочные продукты, сыр, яйца, морепродукты, мясо, рыба, печень, почки, темно-зеленые овощи, зеленый горошек, авокадо, апельсины, бананы, дыни, капуста, морковь, томаты, соя, чечевица, хлеб, кунжутное масло.

В то же время, качество современных продуктов питания, к сожалению, не может гарантировать нам содержания в них ожидаемого количества тех или иных веществ, поэтому поддерживать нужный уровень ниацинамида и витаминов группы В только через корректировку пищевых привычек достаточно трудно. Вероятно поэтому многие пациенты прибегают к добавлению в рацион пищевых добавок. Однако, на данной момент не изучено, какие именно дозировки веществ, полученных не из растительной пищи, а из добавок, являются эффективными и одновременно безопасными, а также насколько целесообразно их потребление при отсутствии подтвержденного дефицита тех или иных нутриентов.

Выходом из сложившейся ситуации становится использование препаратов местного действия – различных дневных и ночных сывороток против выпадения и для роста волос, которые наносятся непосредственно на кожу головы и питают волосяные фолликулы напрямую всем необходимым для их развития.

Выбирайте сыворотки от выпадения волос, содержащие ниацинамид, витамины группы В, а также пептиды.


Избегайте препаратов, содержащих миноксидил.

                                                        Перейти в каталог

Понравилась статья?

Рейтинг 3.9

Голосов (0)

КОМПЛИВИТ ФОРМУЛА РОСТА ВОЛОС N60 КАПС

«КОМПЛИВИТ® Формула роста волос» — специализированный комплекс витаминов, минералов и биологически активных веществ, действие которых направлено против выпадения волос и способствует росту новых волос.

Компоненты комплекса участвуют во всех видах обмена веществ, проявляют антиоксидантные свойства, ускоряют процессы регенерации, способствуют:

• Предотвращению потери волос

• Росту новых волос

• Восстановлению структуры волос

• Предотвращению сечения волос

• Поддержанию силы и упругости волоса

• Укреплению волос

• Поддержанию нормального состояния и функционирования кожи и волос

Содержащийся в комплексе экстракт плодов карликовой пальмы способен блокировать действие фермента 5-альфа-редукгазы и препятствовать превращению тестостерона в дигидротестостерон, который блокирует факторы роста волос, что является частой причиной выпадения волос у женщин и облысения у мужчин. Используется для замедления потери волос, вызванной избытком дигидротестостерона.

Содержание в одной капсуле % от адекватного уровня потребления в одной капсуле

Витамин C, мг 35 58.3

Витамин E, мг 5 50

Витамин A, мг 0,25 31

Витамин B5 (кальция D-пантотенат), мг 2,5 41,6

Витамин B6, мг 1 50

Биотин, мкг 25 50

Цинк, мг 6 40

Марганец, мг 1 50

Медь, мг 0,5 50

Инозит, мг 150 30

Экстракт плодов серенои ползучей (β-ситостерол)0,0128 50

Единственный* специализированный комплекс против выпадения волос, содержащий комбинацию экстракта карликовой пальмы, витаминов и минералов, благодаря которой он работает** в 2-ух направлениях: предотвращает выпадение волос и способствует росту новых волос.

* По данным IMS,октябрь 2016 категория против выпадения волос

** действие компонентов, входящих в состав комплекса

Компоненты комплекса участвуют во всех видах обмена веществ, проявляют антиоксидантные свойства, ускоряют процессы регенерации, способствуют:

Предотвращению потери волос

Росту новых волос

Восстановлению структуры волос

Предотвращению сечения волос

Поддержанию силы и упругости волоса

Укреплению волос

Поддержанию нормального состояния и функционирования кожи и волос

Действие «КОМПЛИВИТ® Формула роста волос» обусловлено свойствами входящих в состав компонентов (по литературным данным):

Витамин С (аскорбиновая кислота) участвует в регулировании окислительно-восстановительных процессов, углеводного обмена, свертываемости крови, регенерации тканей, в метаболизме железа, белков и липидов, атакже в иммунных реакциях, повышает устойчивость организма к инфекциям. Нормализует проницаемость капилляров, участвует в синтезе коллагена, благодаря чему поддерживает в здоровом состоянии кровеносные сосуды, кожу.

Пантотеновая кислота (В5) участвует в углеводном и жировом обмене, ускоряет процессы регенерации, участвует в передаче нервных импульсов. Недостаток витамина В5 может вызывать дерматит, приводить к нарушению роста волос и преждевременной седине.

Витамин В6 (пиридоксин) участвует в обмене веществ; необходим для нормального функционирования центральной и периферической нервной системы, необходим для поддержания оптимального состояния кожи, волос, ногтей. Дефицит витамина В6 может проявляться сухим себорейным дерматитом (в том числе волосистой части головы), тошнотой, потерей аппетита, стоматитом.

Витамин А (ретинол) участвует в формировании зрительных пигментов, необходим для сумеречного и цветового зрения, для роста костей, нормальной репродуктивной функции, обеспечивает целостность эпителиальных тканей, защищает кожу от УФ-излучения. Обладает антиоксидантными свойствами (защищает клеточные структуры от повреждения свободными радикалами). Способствует поддержанию нормальной функции кожи, волос и ногтей. Дефицит в рационе может проявляться сухостью кожи и волос, тусклостью и ломкостью волос и ногтей.

Витамин Е (α-токоферола ацетат) обладает выраженной антиоксидантной активностью, защищает клетки и ткани организма от повреждающего воздействия активных форм кислорода; предупреждает гемолиз эритроцитов; оказывает положительное влияние на функции половых желез, нервной и мышечной ткани.

Биотин участвует в обмене углеводов и жиров. Играет важную роль в поддержании оптимального обмена веществ в коже, волосах и ногтях. Недостаточное поступление биотина в организм приводит к выпадению волос и шелушению кожи.

Цинк входит в состав основных ферментов, участвует в различных биохимических реакциях; в стабилизации клеточных мембран; обладает иммуномодулирующими свойствами, способствует усвоению витамина А, регенерации кожи и росту волос.

Медь способствует антиоксидантной защите клеток, участвует в синтезе коллагена, предупреждает анемию и кислородное голодание органов и тканей, способствует снижению риска развития остеопороза. Укрепляет стенки сосудов. Дефицит меди в организме способствует появлению ранней седины.

Марганец необходим для нормального роста, обмена веществ, процессов остеогенеза, углеводного и липидного обмена. Влияет на развитие костной ткани, участвует в тканевом дыхании, иммунных реакциях. Принимает участие в синтезе меланина.

Инозит — витаминоподобное вещество. Принимает активное участие в формировании мембранных структур клеток и внутриклеточных образований. Недостаток инозита в организме способствует проявлению таких процессов как: выпадение волос; нарушения функции зрения, координации движений, нормального функционирования печени, состояния кожи.

Биологически активные вещества сухого экстракта плодов серенои ползучей (карликовой пальмы), в том числе β-ситостерол, способствуют снижению активности воздействия андрогенных гормонов (таких как дигидротестостерон, блокирующий факторы роста волос) на специфические рецепторы в волосяных фолликулах, что существенно ослабляет процесс потери волос и способствует их росту.

В составе витаминно-минерального комплекса «КОМПЛИВИТ® Формула роста волос» экстракт карликовой пальмы, содержащий β-ситостерол, способствует комплексному (совместно с витаминами и минералами) поддержанию нормального состояния волос, снижению риска их выпадения и усилению роста волос.

желатиновые капсулы белого цвета

Витамины, пищевые добавки, препараты для красоты

Витамины, пищевые добавки, препараты для красоты | kaup24.ee Проверьте статус Вашего заказа Подробнее о Ваших заказах

Выберите свой город

Заберите свой заказ в магазинах Kaup24.ee

Tallinn

Tartu

Narva

Pärnu

Выбор других городов:

— Выберите —Tallinna linnTartu linnNarva linnPärnu linnKohtla-Järve linnViljandi linnRakvere linnMaardu linnSillamäe linnVõru linnAakaru valdAbja valdAbja-PaluojaAbja-Vanamõisa valdAdra valdAegviidu valdAhaste valdAhja valdAhtmeAlajõe valdAlatskivi valdAlbu valdAlutaguse valdAmbla valdAndineeme valdAnija valdAntsla linnAntsla valdAovere valdAre valdArukülaAruvälja valdAseri valdAudru valdAvinurme valdEametsa valdEisma valdElva linnElva valdEmmaste valdHäädemeeste valdHaage valdHaanja valdHaapsalu linnHaapse valdHaaslava valdHalinga valdHaljala valdHaljava valdHalliste valdHanila valdHarku valdHelme valdHerjava valdHiiu valdHiiumaa valdHummuli valdIisaku valdIlli valdIlluka valdIllurma valdImavere valdIntsu valdJägala-Joa valdJärva valdJärva-Jaani valdJärvakandi valdJõelähtme valdJõesuu valdJõgeva linnJõgeva valdJõhvi linnJõhvi valdJüri valdJuuliku valdJuuru valdKaarma valdKaasiku valdKabila valdKabina valdKadrina valdKäesalu valdKäina valdKaiu valdKallaste linnKambja valdKanepi valdKärdla linnKareda valdKarksi valdKarksi-NuiaKärla valdKäru valdKarula valdKasemetsa valdKasepää valdKastre valdKatase valdKehraKehtna valdKeila linnKeila valdKeila-Joa valdKernu valdKibuna valdKihelkonna valdKihlepa valdKihnu valdKiili valdKiisa valdKilingi-Nõmme linnKilksama valdKirumpää valdKiuma valdKiviõli linnKloogaranna valdKoeru valdKohila valdKohtla valdKohtla-Nõmme valdKoigi valdKolga-Jaani valdKõlleste valdKolu valdKonguta valdKõo valdKoonga valdKoppelmaa valdKõpu valdKõrgessaare valdKõrsa valdKose valdKõue valdKrei valdKriimani valdKudjapeKülitse valdKullamaa valdKulli valdKumna valdKunda linnKunda valdKurepalu valdKuressaare linnKurtna valdKuusalu valdLaadi valdLaagriLääne-Harju valdLääne-Nigula valdLääneranna valdLääne-Saare valdLaekvere valdLaeva valdLaheda valdLaiakülaLaimjala valdLaitse valdLasva valdLaukna valdLaulasmaa valdLavassaare valdLeesi valdLehmjaLeisi valdLemmetsa valdLevala valdLihula linnLihula valdLindi valdLohusalu valdLohusuu valdLoksa linnLooLüganuse valdLümanda valdLuunja valdMäeküla valdMäetaguse valdMaidla valdMajaka valdMäksa valdMammaste valdMänniku valdMärjamaa valdMartna valdMeegomäe valdMeeksi valdMeeri valdMeremäe valdMetsaääre valdMetsanurme valdMikitamäe valdMisso valdMõisaküla linnMõniste valdMooste valdMuhu valdMulgi valdMuraste valdMustjala valdMustlaMustvee linnMustvee valdNarva-Jõesuu linnNavi valdNeemisküla valdNissi valdNoarootsi valdNõo valdNõuni valdNõva valdOomiste valdOrava valdOrissaare valdOrjaku valdOru valdÕru valdOtepää linnOtepää valdPadise valdPaide linnPaide valdPäidre valdPaikuse valdPaistu valdPajusi valdPala valdPalamuse valdPaldiski linnPaldiski valdPalupera valdPangodi valdPapsaare valdPäri valdPärsti valdPatika valdPeetriPeetrimõisa valdPeipsiääre valdPihtla valdPiirissaare valdPikva valdPilka valdPinska valdPirgu valdPoaka valdPõdrala valdPõhja-Pärnumaa valdPõhja-Sakala valdPohla valdPöide valdPõltsamaa linnPõltsamaa valdPõlva linnPõlva valdPühalepa valdPuhja valdPuka valdPusku valdPüssi linnPuurmani valdRaasiku valdRaavitsa valdRae valdRägavere valdRahinge valdRaikküla valdRakke valdRakvere valdRandvere valdRannamõisa valdRannu valdRäpina linnRäpina valdRapla linnRapla valdRidala valdRisti valdRõngu valdRoobuka valdRoosna-Alliku valdRõuge valdRuhnu valdRuila valdRuu valdSaarde valdSaare valdSaaremaa valdSaarepeedi valdSaku valdSalme valdSalmistu valdSangaste valdSaue linnSaue valdSauga valdSetomaa valdSindi linnSindi valdSinialliku valdSipa valdSoe valdSõitme valdSõmerpalu valdSõmeru valdSonda valdSoomra valdSõtke valdSuislepa valdSultsi valdSurju valdSuurupi valdTabara valdTabasaluTabivere valdTaebla valdTaheva valdTahkuranna valdTähtvere valdTammejärve valdTammiste valdTammneeme valdTamsalu linnTamsalu valdTänassilma valdTanska valdTapa linnTapa valdTartu valdTarvastu valdToila valdTõlliste valdTootsi valdTorgu valdTori valdTorma valdTõrremäeTõrva linnTõrva valdTõrvandiTõstamaa valdTudulinna valdTüri valdTürisalu valdTuulna valdÜksnurme valdÜlejõe valdÜlenurme valdUrumarja valdUrvaste valdUuemõisa valdUulu valdUusküla valdVääna-Jõesuu valdVäätsa valdVägeva valdVahastu valdVäike-Maarja valdVaivara valdValga linnValga valdVälgita valdValgjärve valdValjala valdValkla valdValkse valdVana-Jõgeva valdVändra (Alev) valdVansi valdVara valdVarbla valdVardi valdVärska valdVarstu valdVasalemma valdVaskjala valdVastse-Kuuste valdVastseliina valdVatsla valdVehendi valdVeibri valdVeriora valdVigala valdVihula valdViimsi valdViiratsi valdViljandi valdVinni valdViraksaare valdVirtsuVirulase valdViru-Nigula valdVissi valdViti valdVõhma linnVoika valdVõistre valdVõlsi valdVõnnu valdVormsi valdVõru valdVõrumõisa valdVõsu vald

Учитывая Ваш выбор, мы в первую очередь покажем наиболее подходящие для Вас пункты выдачи заказов и сроки доставки.

Сохранить

 

 

Просмотреть список товаровСамые дешевые наверхуСамые дорогие наверхуCрок доставкиHаивысшая оценка

Лучшие витамины и пищевые добавки для женщин: что стоит попробовать?

Каждая женщина мечтает о безупречной внешности и отличном самочувствии — чтобы этого добиться, необходимо постоянно заботиться о своем здоровье. В первую очередь нужно побаловать организм изнутри, снабдив его всеми необходимыми питательными веществами. В этом случае особенно будут полезны витамины и

Читать

© 2003-2021 DLB Trading OÜ | kaup24.ee ™
Использование или распространение материалов, опубликованных на этой странице, запрещено.

самые главные элементы для укрепления

Если ты хочешь роскошную гриву как у Златовласки, то читай нашу статью о самых важных витаминах для роста волос.

Выпадение волос — одна из самых распространенных проблем, с которыми сталкиваются женщины. Причин у этого недуга может быть много: от недостатка сна до неправильного ухода. Скрытой причина, о которой многие не догадываются, является нехватка витаминов, которая может привести к осыпанию локонов. Вот самые главные витамины, которые вернут здоровье твоим волосам и заставят их расти как на дрожжах.

Витамин А

Этот витамин регулирует синтез ретиноевой кислоты в волосяном фолликуле. Он не только полезен для ухода за кожей, но и помогает в росте волос, потому что увлажняет волосы и сохраняет их здоровыми. Достаточное потребление витамина А приводит к оптимальной выработке кожного сала, что способствует увлажнению кожи головы для здорового роста волос. Найти ты его можешь в:

  • моркови
  • шпинате
  • других темных листовых зеленых овощах
  • тунце
  • сладком красном перце
  • манго

Витамин В12

Он играет жизненно важную роль в образовании эритроцитов, которые переносят кислород ко всем тканям организма, включая волосы. Исследования показывают, что существует потенциал для оптимального роста волос, если уровень витамина В12 находится в пределах нормы.

Продукты, богатые витамином B12:

  • Сыр
  • Молоко
  • Йогурт

Биотин

Биотин известен как «витамин роста волос». Это один из 12 витаминов в семействе витаминов группы В.

Было проведено исследование для оценки эффективности биотина в росте волос. Результаты показали, что у 18 пациентов с плохим ростом волос и ногтей наблюдалось улучшение после приема биотина. Дефицит этого витамина может стать причиной истончения волос и их выпадения волос.

Продукты, богатые биотином:

  • Грибы
  • Авокадо
  • Яйца
  • Арахисовое масло
  • Семена подсолнечника
  • Цветная капуста
  • Малина
  • Бананы
  • Грецкие орехи
  • Миндаль

Фолиевая кислота

Фолат является водорастворимым витамином В.

Он помогает генерировать эритроциты, которые обеспечивают транспортировку кислорода ко всем тканям, в том числе тем, которые отвечают за рост волос. Он восстанавливает клетки волосяного фолликула и предотвращает выпадение.

Продукты, богатые фолатом:

  • Капуста
  • Шпинат
  • Спаржевая фасоль
  • Салат
  • Брюссельская капуста
  • Зеленый горошек
  • Белые бобы
  • Спаржа
  • Свекла

Витамин С

Этот витамин помогает организму усваивать железо из пищи, что очень важно для роста волос. Он также способствует выработке коллагена, который необходим для поддержания структуры волос и устранения повреждений. Витамин С содержится в:

  • Шпинате
  • Темно-зеленых листовых овощах
  • Болгарском перце
  • Брокколи
  • Киви
  • Апельсинах
  • Лимонах
  • Горохе

Витамин D

Этот витамин стимулирует волосяной фолликул и клетки, так что они образуют новые стержни волос. Витамин D содержится в:

  • Рыбе
  • Устрицах
  • Масле печени трески
  • Тофу
  • Яйцах
  • Грибах

Витамин Е

Он стимулирует капилляры, что улучшает кровообращение в коже головы. Он также способствует росту волос благодаря богатому содержанию антиоксидантов и противовоспалительным свойствам.

Было проведено исследование для изучения влияния витамина Е на 21 человека с выпадением волос. Результаты показали, что в конце 8-месячного испытательного периода количество волосков у участников значительно увеличилось. Это связано с тем, что антиоксидантная активность токотриенолов помогает снизить окислительный стресс в коже головы.

Витамин Е содержится в:

  • Шпинате
  • Тофу
  • Авокадо
  • Миндале
  • Семенах подсолнечника
  • Оливковом масле
  • Брокколи
  • Тыкве

Как отрастить длинные волосы: принимаем витамины для волос

Каждая уважающая себя девушка хоть раз в жизни проходила этот священный ритуал: отрастить волосы, а после — отрезать их под каре. После этого, конечно, мы вновь стараемся вернуть качество и длину волос. Если эта ситуация вам знакома, то давайте разбираться, с помощью каких продуктов и витаминов можно улучшить рост волос, чтобы через полгода гордо помогать своему парню взбираться в окно многоэтажки.

Волосы не грибы — сами по себе не растут, им надо помогать. Они страдают от окружающей среды, нашего питания и постоянных стайлингов. Чтобы волосы росли быстрее, а прическа становилась роскошнее, нужно не только принести жертву Посейдону, но и снабдить волосы необходимыми веществами. Поэтому давайте разберемся, с помощью чего можно отрастить косу до пояса. 

В аптеках и косметических магазинах представлено большое разнообразие витаминов, которые помогают нашим волосам расти. Главное — знать как, что, где брать и употреблять. 

Ретинол

Витамин А или ретинол отвечает за рост волос и ногтей, способствует их здоровому состоянию. Он является натуральным антиоксидантом, который «убирает все лишнее». Без витамина А ваши волосы станут сухими и безжизненными, а с ним заживут новой жизнью.

Чтобы восполнить количество витамина А в организме, можно приобрести этот витамин в чистом виде в любой в аптеке или налегать на продукты. Так, ретинол содержится в печени, морковке, рыбьем жире и шпинате.

Ниацин

Ниацин, он же, витамин В3, — уникальный водорастворимый витамин, который отлично расширяет сосуды. За счет этого свойства, он способствует улучшению циркуляции крови в организме. А, как мы знаем, хороший кровоток способствует здоровому, а самое главное — быстрому росту волос.

Ниацин содержится в шампиньонах, картофеле, красном мясе, сельдерее и креветках. Можно употреблять как на ужин, так и медикаментозно, купив витамин в аптеке.

Биотин 

Биотин или витамин В7 — важный для здоровья волос элемент. Именно биотин позволяет волосам выглядеть блестящими и здоровыми, улучшает внешний вид кончиков и структуру жирных волос. И улучшает рост волос, конечно же. 

Биотин можно найти в яйцах, миндале, бананах, цветной капусте и малине. 

Читать также Как добавить блеск волосам?

Фолиевая кислота

Пользу фолиевой кислоты или витамина В9 переоценить сложно. Именно она дает тот самый «толчок» волосам и заставляет их расти, а также борется с седыми волосами, улучшая их на структурном уровне.

Фолиевая кислота находится в таких продуктах: дыня, горох, чечевица, петрушка. 

Цианокобаламин 

Это сложное название стоит за известным витамином В12, еще одним из группы всемогущего витамина В. Этот витамин отвечает за рост волос и контролирует их выпадение. Витамин укрепляет волосяные луковицы, делая их крепкими, как нервы бывшего. Витамин В12 содержится в мясе, сое и морской капусте. 

Аскорбиновая кислота 

Аскорбиновая кислота или витамин С — самый популярный витамин, который мы знаем с детства. Но, обычно, считается, что детская аскорбинка используется для профилактики простуды и борется с респираторными заболеваниями. Однако, это не все его заслуги. Витамин С способствует выработке белка коллагена, который обязателен для здоровья волос. 

Он защищает наши волосы от так называемого оксидативного стресса, что негативно влияет на структуру волос и разрушает их. Больше всего витамина С находится в киви, клубнике и брокколи. 

Токоферол

Токоферол или витамин Е — один из базовых витаминов, которые отвечают за строение волос. Он положительно и эффективно влияет на кровообращение и питание волос у корней.

Благодаря витамину Е можно получить блестящие и здоровые волосы, улучшить их рост. Содержится витамин Е в орехах, семечках подсолнуха, подсолнечном и сливочном масле.

Читайте также: 5 лучших рецептов питательных масок для волос в домашних условиях

Photo by averie woodard on Unsplash

Материалы по теме:

Как отрастить длинные волосы | блог Expert Clinics

  1. Услуги Expert Clinics
  2. Как отрастить длинные волосы в домашних условиях
  3. Массаж головы
  4. Уходовые средства
  5. Профилактическая стрижка
  6. Мезотерапия
  7. Специализированные витаминные комплексы
  8. Правильное расчесывание волос
  9. Грамотное питание

Длинные и ухоженные волосы остаются символом красоты женщины в любом возрасте. Все мы помним поговорку «Расти коса до пояса, да не вырони ни волоса». Однако следовать за этим высказыванием с каждым годом становится сложнее. Стресс, агрессивные факторы окружающей среды, неправильное питание – всё это отбирает у волос силы и затрудняет их рост. Мы поделимся секретами, как взбодрить волосяные луковицы и настроить их на качественный рост.

Услуги Expert Clinics

Плазмотерапия для волос

Это один из инновационных методов, позволяющий естественным образом восстановить волосяной покров и улучшить его качество.

Плазмотерапия для волос

Мезотерапия для волос

Относительно новая методика уже успела полюбиться и врачам, и пациентам благодаря ее низкой травматичности и хорошим результатам.

Мезотерапия для волос

Лечение гипотиреоза

Лечение и профилактика гипотиреоза крайне важны для сохранения и укрепления здоровья.

Лечение гипотиреоза

Перезвоните мне

Как отрастить длинные волосы в домашних условиях

Сразу сделаем оговорку: не ждите чуда, за 1 месяц волосы не смогут вырасти на 10 сантиметров. Им, как и любому природному процессу, нужно на это определённое время и силы. Поэтому описанные ниже пункты скорее могут помочь сохранить здоровье волос или значительно его укрепить.

· Скрабирование.

Скраб можно использовать как покупной, так и самодельный. Если вы выбрали второй вариант, то вам подойдёт морская соль мелкого помола. Смешайте её с бальзамом или маслом и нанесите на влажные волосы массирующими движениями.

Скрабирование позаботится о своевременном отшелушивании омертвевших клеток, очистит поверхность от накопившегося себума и продуктов стайлинга, облегчит рост новых волос.

· Разогревающие маски. 

Народные рецепты здесь особенно актуальны, так как они просты и практичны. Большой популярностью пользуются такие ингредиенты, как горчица, перец, коньяк, луковый сок, имбирь. К ним часто добавляют яйца, банан, алоэ вера, мёд, овсяные хлопья. Они ускоряют кровообращение в коже головы, укрепляют луковицы, улучшают кислородный обмен.

Если вы обладатель чувствительной кожи, то в начале проведите тест на небольшом участке головы, чтобы избежать аллергических реакций.

· Натуральные масла.

Их можно добавлять в маски, а можно использовать как самостоятельное средство. Масла богаты полиненасыщенными жирными кислотами, что помогает эффективно питать, увлажнять, восстанавливать волосы.  В топ-5 самых полезных масел для волос входит касторовое, репейное, оливковое, масло лаванды, жожоба.


· Выбирайте бессульфатные шампуни.

Хоть содержащиеся в составе большинства средств ухода сульфаты отлично очищают волосы благодаря обильному пенообразованию, они пересушивают кожу головы и постепенно нарушают структуру волос.

В бессульфатных шампунях главным очищающим ингредиентом является тегобетаин. При длительном и регулярном использовании данные средства способны оздоровить волосы и насытить их полезными и питательными веществами. Чтобы не ошибиться, ищите на этикетке маркировку «no SLS/SLES».

· Не ложитесь спать с мокрой головой.

Влажные волосы более уязвимы к повреждениям, а во сне они трутся о подушку, что приводит к их травмированию.

· Не наращивайте волосы.

Капсульное наращивание отягощает луковицы, повреждает их, провоцирует выпадение волос.

· Не злоупотребляйте термоприборами.

Частое использование горячих температур лишает их влаги. Ежедневная сушка и горячая укладка истончает волосы и лишает их влаги.

· Сон и отсутствие стресса.

Стресс и недосыпание оказывают общий негативный эффект на организм, в том числе снижая его защитные функции. Поэтому волосы в таких условиях априори не могут быть здоровыми и быстро расти.

· Дарсонвализация.

Специальный прибор оказывает воздействие переменным импульсным высокочастотным током, помогающим ускорять регенеративные процессы, усиливать микроциркуляцию и стимулировать рост волос.

· Летом и зимой носите головные уборы.

Холод замедляет кровообращение и ослабляет корни, а продолжительное пребывание на солнце иссушает волосы и делает их более слабыми.  

Записаться на консультацию

Массаж головы

Массаж области головы не только поможет расслабиться и снять напряжение, но и в перспективе  обзавестись завидной шевелюрой.


Правила проведения очень просты:

  1. Подогрейте 2 столовых ложки масла (репейного / лавандового / жожоба / касторового).

  2. Окуните кончики пальцев в масло и приступите к массажу: легкими круговыми движениями, двигаясь от лба к затылку по направлению роста волос. Не обходите стороной теменную область, так как в ней сосредоточено множество биологически активных точек.

Массаж головы можно выполнять и с помощью щетки из натуральных материалов (дерева, щетины, эбониты).

Конечно, за неделю или месяц превратить короткую прическу в локоны Рапунцель не получится. Здесь важна регулярность и терпение: возвращайтесь к этому приятному бьюти-ритуалу хотя бы 2-3 раза в неделю.

Уходовые средства

Трихологи и стилисты советуют подходить к вопросу отращивания волос комплексно. Во-первых, использовать не только шампунь и кондиционер, но и дополнительные средства, например, разогревающую маску, спрей-активатор густоты волос, концентраты в ампулах. Во-вторых, обращать тщательное внимание на составы. Качественные средства по уходу за волосами должны содержать:

  • Аминокислоты. Они предотвращают выпадение волос, делают их крепкими, возвращают блеск, силу, запускают процесс выработки собственного коллагена и кератина. 

  • Пантенол. Это провитамин В5. Делает волосы прочнее и эластичнее, обеспечивает эффективное питание волос и кожи головы, способствует росту волос и уменьшению секущихся кончиков.

  • Эмолент кокосового масла. Смягчает и питает волосы.

  • Шёлковые протеины. Ускоряют обменные процессы и способствуют лимфотоку в коже головы.

  • Гидролизованный кератин. Проникает внутрь волоса, разглаживая и заполняя его.

  • Спирулина. Богата витамином А, защищает волосы от УФ-воздействия.

  • Гидроксиэтил мочевины. Увлажняющее вещество естественного происхождения.

  • Гидролизат пшеничного крахмала. Смягчает волосы, защищает их от ломкости.

  • Экстракт овса. Содержит очень важные элементы для формирования структуры белков кожного покрова (минеральные вещества, витамины, аминокислоты, цинк).  

При этом старайтесь отказаться от средств, содержащих парабены, формальдегид, детергенты. Такие компоненты не только не помогут отрастить длинные волосы, но и со временем ухудшают их состояние.

Профилактическая стрижка

Парикмахеры советуют делать профилактическую стрижку 1 раз в 3 месяца. Секущиеся кончики можно сравнить со стрелкой на колготках: если вовремя не заметить, то они занимают всё больше площади, разрушая стержень. Поэтому если вы обнаружили их у себя, то не жалейте, и смело прощайтесь с ними. Как бы парадоксально ни звучало, но регулярная стрижка кончиков помогает в более короткие сроки отрастить здоровые и длинные волосы.

Согласно мнению астрологов, стрижка волос в дни растущей Луны увеличивает скорость их роста, а также укрепляет корни.

Мезотерапия


Какими бы качественными ни были косметические средства, их эффекта для роста волос недостаточно, поэтому действовать следует и изнутри.

На приёме трихологи и косметологи очень часто рекомендуют прохождение курса мезотерапии. Сразу предупредим: инъекции в зону головы – ощущения не из самых приятных, однако по степени эффективности данная методика пока не знает себе равных (за исключением пересадки волос).

Что же такое мезотерапия? Это процедура прицельной доставки питательных веществ с помощью микроинъекций до уровня волосяного фолликула, что вызывает их активацию и переход в стадию роста. Препараты для мезотерапии, в зависимости от цели, содержат около 20-50 полезных действующих веществ, в число которых входят витамины, минералы, пептиды. Поэтому процедура эффективна как в борьбе с потерей волос вследствие дефицитных состояний, так и в лечении андрогенетической алопеции.

Как правило, для достижения максимального результата, требуется 12-15 процедур.

Специализированные витаминные комплексы

Входящие элементы в составе БАДов для роста волос имеют цель предотвратить выпадение волос, сделать их более крепкими, сильными, густыми, активизировать спящие фолликулы.

При выборе витаминных комплексов обязательно проконсультируйтесь с врачом, внимательно читайте состав. В него должны входить:

  • Витамин С. Он защищает кожу головы и стержни волос от повреждения, укрепляет стенки кровеносных сосудов, усиливает кровообращение.

  • Витамин А. Способствует укреплению и правильному развитию волосяных луковиц.

  • Витамин Е. Защищает клетки от свободных радикалов, препятствуя ухудшению состояния волос.

  • Витамин В5. Ускоряет процессы регенерации, участвует в передаче нервных импульсов, усиливает рост волос и препятствует седине.

  • Биотин. Поддерживает оптимальный обмен веществ в волосах. Недостаточное его количество приводит к шелушению и выпадению.

  • Цинк. Стабилизирует клеточные мембраны, способствует усвоению витамина А.

Правильное расчесывание волос


Расчесывать волосы тоже нужно уметь правильно. Делайте это аккуратно, придерживая длину и начиная с кончиков. Затем двигайтесь выше и не забывайте придерживать пряди. Для упрощения процесса можно использовать специальный спрей, содержащий растительные протеины.

Грамотное питание

Для отличного функционирования организму необходимо сбалансированное питание. Основной «строительный материал», обеспечивающий здоровье и красоту волос – это белок. Его вы найдете в рыбе, мясе, яйцах, крупах, орехах.

Мембраностабилизирующее и антиоксидантном действие оказывают омега-3 жирные кислоты. Ими богаты такие продукты питания, как рыба, морепродукты, льняное семя, пророщенные зерна пшеницы, орехи.

Не стоит забывать и про витамины. Употребляйте больше сезонных фруктов, овощей, в особенности чеснок, болгарский перец, шпинат, лимон, облепиху.

Записаться

При обнаружении схожих симптомов проконсультируйтесь у врача. Не занимайтесь самолечением — это опасно для Вашего здоровья!

лучших добавок для волос по мнению диетологов — ешьте это не то, что

Ешьте это, а не то! поддерживается считыватель, и каждый предлагаемый нами продукт проходит независимую проверку нашими редакторами. Когда вы совершаете покупку по ссылкам на нашем сайте, мы можем получать комиссию.

Тусклые, ломкие волосы — это не весело. Как и выпадение волос. К счастью, некоторые питательные вещества могут помочь сохранить и улучшить ваши волосы, и для некоторых людей прием их в виде добавок может быть самым простым способом убедиться, что они получают достаточно хороших веществ, в которых они нуждаются.

«Хотя добавки могут помочь улучшить качество ваших волос, кожи и ногтей (в дополнение к общему состоянию здоровья), предпочтительно, чтобы ваши потребности в питательных веществах удовлетворялись за счет здоровой сбалансированной диеты», — предупреждает Кристин Гиллеспи, штат Массачусетс. , RD, LD , советник Exercisewithstyle.com. «Питательные вещества, содержащиеся в пищевых продуктах, более биодоступны и лучше усваиваются, чем те, которые содержатся в добавках».

Тем не менее, если после разговора со своим врачом или диетологом вы решите, что добавка для поддержания здоровья волос может вам подойти, вот список лучших зарегистрированных диетологов.Читайте дальше, чтобы подготовить волосы к сиянию, как будто вы участвуете в рекламе шампуня, а чтобы узнать больше о том, как правильно питаться, не пропустите 7 самых здоровых продуктов, которые нужно есть прямо сейчас.

Shutterstock

Принесите Bs. «Из витаминов группы B особенно полезен для здоровья волос биотин, — говорит Гиллеспи. «Исследования продемонстрировали связь между дефицитом биотина и выпадением волос. Считается, что помимо биотина, некоторые другие витамины группы B играют роль в росте волос и общем состоянии здоровья, регулируя транспортировку кислорода и важных питательных веществ к коже головы и волосам. фолликулы.«

Гиллеспи говорит, что Pure Encapsulations является отличной витаминной добавкой B-комплекса, которая содержит все витамины B в хорошо усваиваемых формах.

СВЯЗАННО: Подпишитесь на нашу рассылку, чтобы получать ежедневные рецепты и новости еды на свой почтовый ящик!

Shutterstock

Витамин C делает так много удивительных вещей для вашего тела. Возможно, неудивительно, что витамин С также эффективен для сохранения здоровья ваших локонов, как делится Гиллеспи. «Его сильные антиоксидантные свойства позволяют витамину С предотвращать повреждение свободными радикалами, связанное со старением, воспалениями и нездоровой кожей / волосами», — комментирует она.«Кроме того, витамин С играет важную роль в производстве коллагена, который имеет решающее значение для структуры волос».

Гиллеспи нравится добавка витамина С от Amazon Elements, которая не содержит искусственных красителей, ароматизаторов или консервантов.

Shutterstock

«Хотя добавки никогда не могут перевесить диету, когда дело доходит до здоровья волос, нет ничего плохого в том, чтобы включить несколько высококачественных добавок в дополнение к вашему ежедневному режиму питания для дополнительного прироста энергии», — говорит Килен Богден, RDN , a функциональный диетолог и посол Love Wellness.

Она является поклонником коллагена, поскольку он помогает уменьшить толщину волос. «Call Me Collagen от Love Wellness — замечательный продукт для тех, кто надеется улучшить волосы, кожу и ногти. Эти портативные коллагеновые пакеты содержат пептиды с высокой биодоступностью, что облегчает их переваривание и усвоение для вашего тела», — говорит она.

ПОДРОБНЕЕ: Лучшие добавки для ежедневного приема, по мнению диетолога

Shutterstock

Лорен Манакер, MS, RDN, LD , работает диетологом в Zhou Nutrition и является членом организации Eat This, Not That! Совет медицинских экспертов отмечает, что добавка биотина может помочь людям, страдающим от выпадения или истончения волос, если у них есть дефицит.«Прием достаточного количества биотина, который восполняет потребности организма, может принести некоторую пользу», — говорит она.

Подтверждая это, Богден добавляет, что это питательное вещество также известно как B7 и «отлично подходит для роста волос, поскольку оно может стимулировать выработку кератина в волосах и даже увеличивать скорость роста фолликулов». Она призывает потребителей при покупке биотина всегда выбирать сторонние производители пищевых добавок.

Манакер рекомендует средство Hairfluence от Zhou Nutrition, которое содержит биотин, а также многие другие питательные вещества, поддерживающие рост волос, такие как витамин А, который «играет роль в поддержании здоровья волос, а его дефицит связан с нездоровыми волосами.Этот витамин также помогает увлажнять волосы и помогает им выглядеть здоровыми ».

Shutterstock

«Известно, что дефицит витамина D связан с выпадением волос, хотя точный механизм, с помощью которого витамин D способствует росту / здоровью волос, неизвестен», — говорит Гиллеспи. (Чтобы узнать больше о добавках витамина D, ознакомьтесь с этим руководством, чтобы узнать, что вам следует знать, прежде чем принимать эту добавку.)

«Vital Choice — это хорошая добавка витамина D, содержащая масло лосося; не только масло лосося содержит жирные кислоты омега-3, которые необходимы вашему организму, но эти жирные кислоты также способствуют усвоению витамина D, учитывая его классификацию как жирорастворимый витамин. «, — добавляет она.

Shutterstock

Да, этот макроэлемент, который помогает вам наращивать мышцы, также сохраняет ваши волосы в отличной форме. «Адекватное потребление белка более важно, чем многие другие питательные вещества, когда речь идет о росте волос», — говорит Богден. «К сожалению, многие из нас не потребляют достаточно, чтобы поддерживать оптимальное здоровье. Отличный способ решить это препятствие — ежедневно употреблять высококачественный протеиновый порошок», — продолжает она, добавляя, что определенные исследования показали, что дефицит протеина может уменьшить волосы. рост и даже привести к выпадению волос.

Богден любит варианты сыворотки травяного откорма, такие как Stronger Faster Healthier или 100% протеиновые порошки на растительной основе, такие как Garden of Life.

55,99 долл. США сильнее, быстрее, здоровее

купить сейчас Shutterstock

Питательные вещества, поддерживающие здоровье кожи, также могут улучшить качество ваших волос. «Дисбаланс питания может проявляться в выпадении или ломкости волос. Иногда вам может потребоваться дополнительная поддержка в виде пищевых добавок для оптимального здоровья волос», — говорит Мина Патель, RD , мануальный терапевт и руководитель отдела диетологии в BestOfU.«Сосредоточьтесь на продуктах или добавках, богатых белком, омега-3 жирными кислотами, витаминами B-комплекса, жирорастворимыми витаминами, витамином C и железом для правильного питания ваших волос».

Ее рекомендации? Набор Thorne для здоровья кожи, предназначенный для ухода за кожей, волосами и ногтями, включает в себя их биотин-8, Омега Плюс и витамин С с флавоноидами.

Прочтите следующее:

15 лучших продуктов для роста волос

ЛисовскаяGetty Images

Когда дело доходит до густых и здоровых волос, мы засыпаем тоннами средств по уходу за волосами, обещающих улучшить внешний вид наших волос.Многие из нас забывают, что правильное питание — одна из важнейших составляющих питания этих великолепных локонов. Сбалансированная диета, состоящая преимущественно из растений, может помочь вам получить ключевые питательные вещества, необходимые для поддержания ваших волос, кожи и ногтей в отличной форме. Лучшие витамины и питательные вещества для роста волос включают нежирные белки, жирные кислоты омега-3, жирорастворимые витамины, витамины группы B и железо. План питания в средиземноморском стиле, включающий продукты с высоким содержанием клетчатки, 100% цельнозерновые и полезные жиры, — один из самых простых способов получить эти необходимые питательные вещества.

С другой стороны, то, что вы едите, также может сильно повлиять на выпадение волос. Подумайте о замене обработанных и упакованных продуктов, которые очень бедны питательными веществами, на более цельные, настоящие и натуральные продукты. Многие из этих обработанных продуктов содержат добавки и искусственные ингредиенты, которые вам просто не нужны. Кроме того, эти обработанные продукты могут нанести вред кишечнику. Наличие здоровой микрофлоры кишечника необходимо для усвоения питательных веществ, укрепляющих волосы, кожу и ногти.

Если вы недавно заметили значительную потерю волос, первым делом следует проконсультироваться с врачом, поскольку это может указывать на основное заболевание.Прежде чем начинать какой-либо режим приема добавок, вы всегда должны сначала поговорить со своим врачом. Хотя дополнительные витамины группы B могут помочь в определенных случаях (например, если у вас есть основное заболевание, вызывающее дефицит), они также могут вызывать негативные эффекты, например, опасное изменение результатов лабораторных анализов. Добавки также часто содержат ненужный биотин, который намного превышает то, что ваше тело может фактически использовать. Учитывая, что большинство людей могут получать все необходимые им витамины группы B с пищей, покупка этих добавок, вероятно, будет пустой тратой денег.

Когда дело доходит до определенных продуктов, вы захотите съесть эти здоровые волосы всех звезд и как можно скорее добавить их в свою продуктовую тележку.

* Дополнительная информация от Jaclyn London, MS, RD, CDN

Реклама — продолжить чтение ниже

2 Яйца

Яйца полны белка и необходимых питательных веществ, которые способствуют здоровью волос, таких как холин и витамины A, D и B12.Убедитесь, что вы сохраняете желток в своей борьбе, чтобы получить как можно больше витамина D. Два конкретных каротиноида, обнаруженные в яйцах, лютеин и зеаксантин, также играют роль в поддержании здоровья клеток, особенно глаз, кожи и волос.

3 Арахис и арахисовое масло

Арахис — важный источник биотина, который, как известно, стимулирует рост волос и предотвращает их выпадение. В порции чашки содержится до 9 граммов белка, 4 грамма клетчатки и уникальный профиль антиоксидантов.Арахис — это также начинка super , поэтому он идеально подходит для замены мяса, если вы вегетарианец или веган.

СВЯЗАННЫЕ: 50+ веганских рецептов, которые понравятся всей вашей семье

4 Шпинат

Шпинат богат магнием, железом и фолиевой кислотой, одним из важнейших витаминов группы В. Другая листовая зелень, такая как капуста, также богата питательными веществами для кожи и волос. Кроме того, витамин С в этих темно-зеленых листовых овощах помогает защищать и поддерживать клеточные мембраны волосяных фолликулов.

6 Семена чиа

Ищете вегетарианский или веганский источник омега-3? Семена чиа богаты ими, не говоря уже о клетчатке и антиоксидантах. Этот источник питания считается полноценным белком, содержащим на 20% больше белка, чем соевые бобы, и может способствовать созданию красивых и сочных прядей. Эти крошечные семена длительного хранения можно добавлять в хлопья, смузи, пудинги и даже в выпечку, чтобы укрепить здоровье сердца.

7 Тыква

Полчашки вашей любимой тыквы содержит всего 83 калории и менее грамма жира. Кроме того, он богат железом и бета-каротином, предшественником витамина А — важного витамина для роста и силы волос. Тыква также полна витаминов C и E, которые помогают восстанавливать клетки вашего тела от повреждений. Загрузите консервированное пюре и используйте его в соусах, белковых блюдах и даже в закусках, чтобы волосы оставались здоровыми.

СВЯЗАННЫЕ: 40+ сладких и пикантных рецептов из тыквы

8 Авокадо

Тост с авокадо никогда не выйдет из моды, и не зря! Авокадо, богатый полезными жирами, содержит витамин Е, который является мощным антиоксидантом, способствующим росту волос. Авокадо также содержит биотин и является популярным ингредиентом многих масок для волос, сделанных своими руками.

9 Виноград

Как и другие продукты растительного происхождения, виноград содержит полифенольные соединения с антиоксидантными свойствами, которые могут помочь уменьшить повреждение клеток.Олигомерные проантоцианидины (OPC), содержащиеся в винограде, помогают предотвратить выработку дигидротестостерона, который является основным фактором выпадения волос. OPC также стимулирует рост волосяных фолликулов. Съедание примерно чашки винограда в день может помочь защитить ткани от воспаления.

10 Гречневая крупа

Замена белых рафинированных углеводов на 100% цельнозерновые может помочь вам увеличить количество клетчатки, цинка, железа и витаминов группы B в вашем рационе для поддержания здоровья волос.Гречка, считающаяся цельным зерном, является питательным семенами без глютена, и ее преимущества безграничны. Гречка наполнена основными антиоксидантами и клетчаткой, которые помогут вам быстрее насытиться. Используйте его вместо овсянки на завтрак или риса в жарком, а также попробуйте удон на основе гречки при приготовлении рамена или других блюд из лапши.

11 Льняное семя

Семена льна богаты полиненасыщенными жирными кислотами, которые помогают питать кожу головы и предотвращают сухость.Посыпьте йогурт молотыми семенами льна, добавьте немного в смузи или создайте собственное льняное яйцо, которое заменит настоящее яйцо в любых рецептах выпечки. Добавьте одну столовую ложку молотых семян льна к трем столовым ложкам воды и оставьте на пять минут, чтобы они загустели; это веганский однозначный обмен на обычное яйцо.

12 Сладкая картошка

Этот антиоксидант, содержащий бета-каротин, придающий сладкому картофелю оранжевый оттенок, превращается в витамин А, который защищает от сухих и тусклых волос.Сладкий картофель содержит значительно больше витамина А и немного больше клетчатки, чем белый картофель. Сладкий картофель также играет важную роль в поддержании иммунитета и здорового зрения.

13 Нут, чечевица, фасоль и горох

Все эти четыре вида считаются бобовыми, иначе говоря, сухими съедобными семенами овощей. Они богаты растительным белком и клетчаткой, что делает их очень сытными и зачастую более экономичными, чем покупка мяса.Эти продукты также богаты фолиевой кислотой, которая является одним из витаминов группы B, который помогает поддерживать здоровье волос и обновлять клетки, жизненно важные для роста волос. Попробуйте продукты на основе пульса, такие как паста Banza и RightRice, вместо традиционных версий из очищенного зерна для повышения питательной ценности.

15 Простой греческий йогурт

Несладкий простой греческий йогурт содержит тонны белка, который является строительным материалом для этих великолепных замков.Кроме того, простой греческий йогурт очень универсален и может быть использован в качестве сытного завтрака (например, смузи и парфе) или пикантных блюд (например, соусов и приправ). Самым большим атрибутом йогурта являются пробиотики, полезные бактерии, которые помогают организму усваивать питательные вещества. Выбирайте бренды, которые содержат пять или более штаммов бактериальных культур на порцию на 6 унций.

Этот контент создается и поддерживается третьей стороной и импортируется на эту страницу, чтобы помочь пользователям указать свои адреса электронной почты.Вы можете найти дополнительную информацию об этом и подобном контенте на сайте piano.io.

Реклама — продолжить чтение ниже

Необходимые витамины, которые необходимо принимать для роста волос

Клиенты Rush всегда спрашивают нас, как отрастить волосы дольше. Самый простой способ обеспечить рост локонов — убедиться, что ваше тело получает необходимые ему витамины. Мы собрали 6 лучших витаминов, необходимых для роста волос!

Витамин A

Витамин A способствует образованию кожного сала на коже головы, что предотвращает высыхание и ломкость волос.Этот витамин необходим для правильного роста клеток. Есть много видов продуктов, которые содержат витамин А, таких как морковь, сладкий картофель, мускатная тыква и капуста.

Витамин B

Второй витамин, необходимый для роста волос, — это витамин B, в категории B восемь витаминов (B1, B2, B3, B5, B6, B7, B9 и B12), и вы можете сказать, нет ли у вас не принимаете достаточное количество витамина B, потому что ваши волосы могут расти не так быстро, как привыкли. Хорошие продукты, обогащенные витамином B: сыр, яйца и красное мясо.

Витамин C

Этот витамин помогает укрепить волосы и способствовать их росту. Это потому, что витамин С помогает организму вырабатывать коллаген, который необходим для здоровых волос. Вы можете принимать добавки с витамином С или, например, просто начать есть продукты с высоким содержанием витамина С; капуста, брокколи, киви и клубника.

Витамин D

Самый простой способ повысить уровень витамина D — это провести некоторое время на солнце, поскольку этот витамин способствует росту фолликулов.В зимние месяцы для получения сочных длинных локонов вам необходимо есть продукты, богатые витамином D, такие как лосось, молоко, яйца, и принимать добавки с витамином D.

Витамин E

Витамин E — антиоксидант, он восстанавливает и укрепляет ткани. Он восстанавливает поврежденные волосяные фолликулы и может улучшить кровообращение, если нанести его на кожу головы. Вы можете купить масло с витамином Е и массировать его кожу головы не реже двух раз в неделю, это будет способствовать росту волос. Витамин Е содержится в семенах подсолнечника, орехах и авокадо.

Витамин К

Включение витамина К в ваш рацион помогает поддерживать здоровье волос. В шпинате содержится витамин К, а также в зеленой фасоли, брокколи и капусте.

Пожалуйста, проконсультируйтесь с врачом перед тем, как вносить какие-либо изменения в рацион.

Если вы хотите получить дополнительную информацию о том, как сохранить волосы здоровыми, найдите ближайший салон Rush и загляните в него, чтобы узнать больше.

Аналоги витамина D3 стимулируют рост волос у голых мышей | Эндокринология

Абстрактные

Активная форма витамина D 3 может регулировать кератинизацию эпидермиса, индуцируя терминальную дифференцировку; а у мышей, лишенных рецептора витамина D, обнаруживаются дефекты, приводящие к послеродовой алопеции.Эти наблюдения показывают, что витамин D 3 участвует в регуляции роста волос. Мы проверили способность 1,25 дигидроксивитамина D 3 и его синтетических аналогов стимулировать рост волос у мышей biege / nude / xid (BNX) nu / nu (nude) с врожденной алопецией. Голых мышей лечили различными аналогами витамина D 3 в дозах, которые, как мы ранее обнаружили, являются наивысшими дозами, не вызывающими токсичности (гиперкальциемии). За мышами наблюдали рост волос и оценивали их по определенной шкале.Образцы кожи были взяты для гистологического исследования волосяных фолликулов и для экстракции РНК и белка. Аналоги витамина D 3 резко стимулировали рост волос у голых мышей, хотя исходный 1,25 дигидроксивитамин D 3 не имел никакого эффекта. Рост волос происходил по циклической схеме, сопровождавшейся образованием нормальных волосяных фолликулов и повышенной экспрессией определенных кератинов (Ha7, Ha8 и Hb3). Аналоги витамина D 3 , по-видимому, действуют на кератиноциты, инициируя круговорот волосяных фолликулов и стимулируя рост волос у мышей, у которых в противном случае волосы не растут.

В ходе наших исследований противоопухолевых свойств аналогов витамина D 3 мы обычно использовали мышей с тройным иммунодефицитом beige / nude / xid (BNX) nu / nu (nude) для проверки способности этих соединений предотвращать рост опухоли in vivo . Мы заметили, что у голых мышей росли волосы, когда они получали некоторые аналоги витамина D 3 .

У голых мышей есть изменение зародышевой линии гена Whn (недавно названного Foxn1), влияющее как на рост фолликулярных волос, так и на развитие тимуса (1, 2).У этих мышей ген Whn имеет делецию одного нуклеотида, вызывающую мутацию со сдвигом рамки считывания с преждевременным завершением, что приводит к нефункциональному белку. Ген Whn, фактор транскрипции вилки, экспрессируется исключительно в эпителиальных клетках у всех видов позвоночных. Гены Whn человека и мыши имеют 85% идентичности последовательностей (2). Люди с фенотипом обнаженного тела также имеют врожденную алопецию в результате бессмысленной мутации этого гена (3). Необходимо определить транскрипционные мишени Whn, но они включают гены кератина в волосяном фолликуле.Whn необходим для созревания и дифференцировки матричных эпителиальных клеток. Обычно он экспрессируется в луковице фолликула и наружной корневой оболочке стержня волоса во время образования волос; Отсутствие этого генного продукта у голых мышей приводит к неправильному ороговению фолликулярных эпителиальных клеток, что приводит к дефектам корневого влагалища, кутикулы и коры головного мозга, что приводит к ослаблению волос (2, 4, 5). Волосы расслаиваются в фолликуле, образуя кожные кисты (4), содержащие ороговевший материал.

Активная форма витамина D 3 является лигандом для рецептора ядерного гормона, рецептора витамина D 3 (VDR).Мыши с нокаутом VDR не могут инициировать новый цикл роста волос, проявляя послеродовую алопецию (6). Экспрессия VDR в дермальных сосочках в фолликулярных кератиноцитах во время стадий анагена (рост) и катагена (прекращение) цикла волос предполагает роль VDR в прогрессировании цикла волос (7). Кроме того, обработка кератиноцитов тремя аналогами витамина D 3 ингибировала пролиферацию и стимулировала дифференцировку (8).

Эти наблюдения побудили нас изучить способность аналогов витамина D 3 стимулировать рост волос у голых мышей с дефектами кератиноцитов.Было разработано большое количество аналогов витамина D 3 , которые обладают большей способностью вызывать дифференцировку и ингибировать пролиферацию, но вызывают меньшую гиперкальциемию, чем физиологически активное соединение 1,25 дигидроксивитамин D 3 [1,25 (OH ) 2 D 3 ] (9). Мы выбрали шесть аналогов витамина D 3 , которые соответствовали этим характеристикам, и исследовали их способность вызывать рост волос у голых мышей (10–15).

Материалы и методы

Мыши

В наших исследованиях использовались

BNX nu / nu самцов и самок мышей в возрасте 8 недель.Животные содержались в помещении для животных Медицинского центра Сидарс-Синай, и эксперименты проводились в соответствии с установленными правилами. В одной серии экспериментов по три мужчины были распределены в каждую из шести групп, и каждая когорта получала различное соединение витамина D 3 , а седьмая группа состояла из необработанного контроля BNX nu / nu . Кроме того, трем самцам и трем самкам мышей вводили аналог витамина D 3 , EB1089. Все аналоги вводили внутрибрюшинно три раза в неделю в объеме 200 мкл PBS.Для экспериментов по выщипыванию волос выщипывали волосы из нижней части спины мышей C57 BL / 6 и вводили аналоги витамина D 3 , как описано выше.

Витамин D

3 соединений

Соединения витамина D 3 (рис. 1) растворяли в абсолютном этаноле перед определением молярной концентрации, измеренной по УФ-поглощающей способности с использованием их молярного коэффициента экстинкции при 264 нм. Все аналоги хранили в темноте и при -80 ° C в абсолютном этаноле в качестве исходных растворов 10 -3 мкМ.Последнее разведение было сделано в PBS перед введением мышам. Мышам вводили дозы соединений витамина D 3 , которые, как мы ранее обнаружили, не вызывают токсичности, включая гиперкальциемию. Кроме того, во время лечения мы контролировали уровень кальция в сыворотке крови.

Рисунок 1.

Физическая структура витамина D 3 соединений, использованных в этом исследовании.

Рисунок 1.

Физическая структура витамина D 3 соединений, использованных в этом исследовании.

1,25- (ОН)
2 D 3

1α, 25-дигидроксихолекальциферол, физиологически активная форма витамина D 3 , вводили в дозе 0,0625 мкг / мышь; это было сделано Hoffman-LaRoche Inc.

Ro 25-9022

1α, 25- (OH) 2 -16-ен-23-ин-26,27-F6–19-нор-витамин D 3 имеет шесть фторов в боковой цепи, ненасыщенность по C16 и C23, и удаление метиленовой группы C-19. Его вводили на уровне 0.00125 мкг / мышь. Аналог произведен компанией Hoffman-LaRoche Inc.

KH 1060
.

1α, 25- (OH) 2 -20-epi-22-окса-24,26,27-тришомовитамин D 3 имеет удлинение боковой цепи и замену углерода C 22 на кислород. Он был произведен Leo Pharmaceuticals и вводился в дозе 0,0125 мкг / мышь.

EB1089

1α, 25- (OH) 2 -диен-24,26,27-тригомовитамин D 3 имеет измененную боковую цепь с 26,27 диметильными группами со вставкой дополнительного углерода в C- 24 (24a) и две транс двойные связи при атомах углерода 22,23 и 24,24a.Он был произведен Leo Pharmaceuticals и давался в дозе 0,05 мкг / мышь.

Ro 27-0574

1α, 25 (OH) 2 -23-ен-26,27-гексафтор-19-нор-20-циклопил-витамин D 3 содержит шесть фторов в боковой цепи, транс-23,24 двойной связь и циклопропильная группа при C 20 . Он был произведен Hoffman-LaRoche Inc. и давался в дозе 0,005 мкг / мышь.

Ro 27-5646

1α, 25 (OH) 2 — (3-метил-3-гидроксибутил) -19-нор-витамин D 3 имеет две боковые цепи с удалением метиленовой группы C-19 и был задан при 0.01 мкг / мышь. Это было сделано Hoffman-LaRoche Inc.

Ro 26-9114

1α, 25 (OH) 2 -16-ен-19-нор-24-оксо-витамин D 3 содержит двойную связь у C-16 и кетогруппу в боковой цепи. Он был синтезирован Hoffman-LaRoche Inc. и вводился в дозе 6 мкг / мышь.

Весы для мониторинга волос у мышей BNX nu / nu

Мы разработали шкалу для измерения роста волос у мышей BNX (таблица 1).

Таблица 1.

Весы для мониторинга волос в мышах BNX nu / nu

SCORE . ОПИСАНИЕ .
1 Кожа розовая, без волос
2 Кожа толстая, пигментированная, без волос
3 Кожа толстая, сильно пигментированная, без волос
Кожа толстая, пигментированная, рассеянные волосы
5 Волосы 1–10% тела
6 Волосы 10–25% тела
7 Волосы 25–50% тела
8 Волосы 50–75% тела
9 Волосы> 75% тела
10 Волосы 100% тела
. ОПИСАНИЕ .
1 Кожа розовая, без волос
2 Кожа толстая, пигментированная, без волос
3 Кожа толстая, сильно пигментированная, без волос
Кожа толстая, пигментированная, рассеянные волосы
5 Волосы 1–10% тела
6 Волосы 10–25% тела
7 Волосы 25–50% тела
8 Волосы 50–75% тела
9 Волосы> 75% тела
10 Волосы 100% тела
Таблица 1.

Весы для мониторинга волос в мышах BNX nu / nu

SCORE . ОПИСАНИЕ .
1 Кожа розовая, без волос
2 Кожа толстая, пигментированная, без волос
3 Кожа толстая, сильно пигментированная, без волос
Кожа толстая, пигментированная, рассеянные волосы
5 Волосы 1–10% тела
6 Волосы 10–25% тела
7 Волосы 25–50% тела
8 Волосы 50–75% тела
9 Волосы> 75% тела
10 Волосы 100% тела
. ОПИСАНИЕ .
1 Кожа розовая, без волос
2 Кожа толстая, пигментированная, без волос
3 Кожа толстая, сильно пигментированная, без волос
Кожа толстая, пигментированная, рассеянные волосы
5 Волосы 1–10% тела
6 Волосы 10–25% тела
7 Волосы 25–50% тела
8 Волосы 50–75% тела
9 Волосы> 75% тела
10 Волосы 100% тела

Гистологический анализ волосяных фолликулов

Образцы кожи были получены после обработки либо соединениями витамина D 3 , либо контрольным разбавителем.Их фиксировали для гистологического анализа в 10% нейтральном забуференном формалине, окрашивали гематоксилином / эозином и исследовали под микроскопом.

Анализ РНК

Образцы кожи мышей с максимальной оценкой были обработаны на РНК, преобразованы в кДНК и использованы в ПЦР для проверки экспрессии генов различных кератинов (10). Праймеры для генов кератина показаны в таблице 2.

Таблица 2.

Праймеры для генов кератина

Кератиновый тип волос . Праймер прямой . Обратный праймер .
кератина A1 AGCTGTGACCTGGCTCTGGTTC CCACTGGCACATCAGAGAGTTC
кератина A4 TCTGGAGCTCAGCTGACATC ACCTTAAGTAGTAACTGGAGCTC
кератина A7 CCCTAAATCAACCGGTAGCAG TTTAATGCAGGGAACCCAGTTAC
кератина A8 CTGGCTAAGGCGGGAGATAC GTAGCTGACATCCAGCCAC
Кератин B3 AGCAGAGGCTGTGTGAAGGTG GGAAAAGCCAGCGATGTGCTG
Кератиновый тип волос . Праймер прямой . Обратный праймер .
кератина A1 AGCTGTGACCTGGCTCTGGTTC CCACTGGCACATCAGAGAGTTC
кератина A4 TCTGGAGCTCAGCTGACATC ACCTTAAGTAGTAACTGGAGCTC
кератина A7 CCCTAAATCAACCGGTAGCAG TTTAATGCAGGGAACCCAGTTAC
кератина A8 CTGGCTAAGGCGGGAGATAC GTAGCTGACATCCAGCCAC
Кератин B3 AGCAGAGGCTGTGTGAAGGTG GGAAAAGCCAGCGATGTGCTG
Таблица 2.

Праймеры для генов кератина

Волосы кератинового типа . Праймер прямой . Обратный праймер .
кератина A1 AGCTGTGACCTGGCTCTGGTTC CCACTGGCACATCAGAGAGTTC
кератина A4 TCTGGAGCTCAGCTGACATC ACCTTAAGTAGTAACTGGAGCTC
кератина A7 CCCTAAATCAACCGGTAGCAG TTTAATGCAGGGAACCCAGTTAC
кератина A8 CTGGCTAAGGCGGGAGATAC GTAGCTGACATCCAGCCAC
Кератин B3 AGCAGAGGCTGTGTGAAGGTG GGAAAAGCCAGCGATGTGCTG
Кератиновый тип волос . Праймер прямой . Обратный праймер .
кератина A1 AGCTGTGACCTGGCTCTGGTTC CCACTGGCACATCAGAGAGTTC
кератина A4 TCTGGAGCTCAGCTGACATC ACCTTAAGTAGTAACTGGAGCTC
кератина A7 CCCTAAATCAACCGGTAGCAG TTTAATGCAGGGAACCCAGTTAC
кератина A8 CTGGCTAAGGCGGGAGATAC GTAGCTGACATCCAGCCAC
Кератин B3 AGCAGAGGCTGTGTGAAGGTG GGAAAAGCCAGCGATGTGCTG

Анализ белков

Антисыворотки против кератиновых белков использовали для вестерн-блоттинга для установления паттернов экспрессии на уровне белка (16, 17).Одна антисыворотка была против кислого кератина волоса типа I Ha8, который обычно проявляет сложный характер экспрессии в растущих фолликулах; и вторым признанным основным кератином волос типа II Hb3.

Результаты

Голые мыши получали либо соединения витамина D 3 , либо контрольный разбавитель в дозе, которая, как мы ранее обнаружили, ингибировала клональную пролиферацию раковых клеток, но не была связана с гиперкальциемией, которая является основной токсичностью витамина D 3 (Таблица 3 , Инжир.1, и ссылки. 10–13). У этих мышей развились волосы, как показано на фиг. 2. Гистологическое исследование подтвердило, что аналоги витамина D 3 стимулировали образование волосяных фолликулов (фиг. 3). Наблюдение под микроскопом образцов кожи с пиком 8 в группах лечения аналогом витамина D 3 показало полностью сформированный волосяной фолликул; Напротив, в контрольных образцах не наблюдали волосяного фолликула или только деформированные волосяные фолликулы.

Рисунок 2.

Фотография голых мышей.A. Верхняя мышь получала контроль с разбавителем, а мышь нижняя получала аналог витамина D 3 , Ro 25-9022 в дозе 0,00125 мкг / мышь внутрибрюшинно три раза в неделю. B. Мыши получали слева направо : Ro 27-5646 в концентрации 0,01 мкг / мышь, контроль с разбавителем, и Ro27-0574 в концентрации 0,005 мкг / мышь.

Рисунок 2.

Фотография голых мышей. A. Верхняя мышь получала контроль разбавителя, а мышь нижняя получала аналог витамина D 3 , Ro 25-9022, при 0.00125 мкг / мышь, внутрибрюшинно, три раза в неделю. B. Мыши получали слева направо : Ro 27-5646 в концентрации 0,01 мкг / мышь, контроль с разбавителем, и Ro27-0574 в концентрации 0,005 мкг / мышь.

Рис. 3.

A, Кожа контрольной голой мыши с абортивными волосяными фолликулами и рудиментарными волосянистыми единицами. Подопытная голая мышь (B) обнаружила нормальные волосяные фолликулы, простирающиеся в подкожную ткань. Эта мышь получала Ro 25-9022 в дозе 0,00125 мкг / мышь внутрибрюшинно три раза в неделю в течение 36 дней (см.2). Срезы окрашивали гематоксилином и эозином (исходное увеличение × 100).

Рис. 3.

A, Кожа контрольной «голой мыши» с абортивными волосяными фолликулами и рудиментарными волосяными клетками. Подопытная голая мышь (B) обнаружила нормальные волосяные фолликулы, простирающиеся в подкожную ткань. Эта мышь получала Ro 25-9022 в дозе 0,00125 мкг / мышь внутрибрюшинно три раза в неделю в течение 36 дней (см. Фиг. 2). Срезы окрашивали гематоксилином и эозином (исходное увеличение × 100).

Таблица 3.

Витамин D 3 соединений: сводка их антипролиферативной и кальциемической активности

EB 1,2367 (OH)
Соединения . ED 50 (м) . Максимальная негиперкальциемическая доза . Арт. .
HL60 . MCF-7 .
Ro 27-5646 2 × 10 −10 4 × 10 −10 0.01 мкг / мышь 10
Ro 27-0574 2 × 10 −10 2 × 10 −9 ND a 14
5 × 10 −11 0,5 мкг / кг 12
Ro 26-9114 1 × 10 −10 6 мкг / мышь 6 мкг / мышь
Ro 25-9022 2 × 10 −10 6 × 10 −10 0.00125 мкг / мышь 15
KH 1060 1 × 10 −12 1 × 10 −10 0,0125 мкг / мышь 13
2 D 3 1 × 10 −8 1 × 10 −7 0,0625 мкг / мышь 10, 11, 12, 13, 14, 15
Соединения . ED 50 (м) . Максимальная негиперкальциемическая доза . Арт. .
HL60 . MCF-7 .
Ro 27-5646 2 × 10 −10 4 × 10 −10 0,01 мкг / мышь 10
Ro 27-0576 2 377 −10 2 × 10 −9 ND a 14
EB 1089 5 × 10 −11 0.5 мкг / кг 12
Ro 26-9114 1 × 10 −10 6 мкг / мышь 11
Ro 25-9022 — 10 × 10 10 6 × 10 −10 0,00125 мкг / мышь 15
KH 1060 1 × 10 −12 1 × 10 −10 0,0125 мкг / мышь 13
1,25 (OH) 2 D 3 1 × 10 −8 1 × 10 −7 0.0625 мкг / мышь 10, 11, 12, 13, 14, 15
Таблица 3.

Соединения витамина D 3 : сводка их антипролиферативной и кальциемической активности

EB 1,2367 (OH)
Соединения . ED 50 (м) . Максимальная негиперкальциемическая доза . Арт. .
HL60 . MCF-7 .
Ro 27-5646 2 × 10 −10 4 × 10 −10 0.01 мкг / мышь 10
Ro 27-0574 2 × 10 −10 2 × 10 −9 ND a 14
5 × 10 −11 0,5 мкг / кг 12
Ro 26-9114 1 × 10 −10 6 мкг / мышь 6 мкг / мышь
Ro 25-9022 2 × 10 −10 6 × 10 −10 0.00125 мкг / мышь 15
KH 1060 1 × 10 −12 1 × 10 −10 0,0125 мкг / мышь 13
2 D 3 1 × 10 −8 1 × 10 −7 0,0625 мкг / мышь 10, 11, 12, 13, 14, 15
Соединения . ED 50 (м) . Максимальная негиперкальциемическая доза . Арт. .
HL60 . MCF-7 .
Ro 27-5646 2 × 10 −10 4 × 10 −10 0,01 мкг / мышь 10
Ro 27-0576 2 377 −10 2 × 10 −9 ND a 14
EB 1089 5 × 10 −11 0.5 мкг / кг 12
Ro 26-9114 1 × 10 −10 6 мкг / мышь 11
Ro 25-9022 — 10 × 10 10 6 × 10 −10 0,00125 мкг / мышь 15
KH 1060 1 × 10 −12 1 × 10 −10 0,0125 мкг / мышь 13
1,25 (OH) 2 D 3 1 × 10 −8 1 × 10 −7 0.0625 мкг / мышь 10, 11, 12, 13, 14, 15

Мы исследовали рост волос голых мышей, когда они получали разбавитель (контрольные мыши), 1,25 (OH) 2 D 3 , или один из пяти аналогов витамина D 3 . Каждая группа состояла из трех мышей. Влияние аналогов витамина D 3 на рост волос голых мышей систематически оценивали для каждой мыши, выставляя им баллы по шкале от 1 до 10 (таблица 1), три раза в неделю. Оценка роста волос учитывает толщину и пигментацию кожи, поскольку это косвенно коррелирует с индукцией анагена, который является фазой роста волосяного цикла.Например, оценка 5 представляет утолщение кожи с сильной пигментацией, что отражает формирование стержня волоса до выступа волос над поверхностью кожи. Время до появления волос и количество волос варьировали от мыши к мыши и для аналогов витамина D 3 (фиг. 4).

Рисунок 4.

Влияние соединений витамина D 3 на рост волос у мышей nude. Мышей лечили соединениями витамина D 3 внутрибрюшинно три раза в неделю и оценивали рост волос в соответствии с определениями, приведенными в таблице 1.Каждая панель показывает репрезентативные эксперименты. Все мыши были самцами, за исключением самок, показанных на F. *, P <0,05; #, P <0,05 для самок мышей, представленных в F.

Рисунок 4.

Влияние соединений витамина D 3 на рост волос у голых мышей. Мышей лечили соединениями витамина D 3 внутрибрюшинно три раза в неделю и оценивали рост волос в соответствии с определениями, приведенными в таблице 1. На каждой панели показаны репрезентативные эксперименты.Все мыши были самцами, за исключением самок, показанных на F. *, P <0,05; #, P <0,05 для самок мышей, представленных в F.

Максимальный показатель роста волос был постоянно выше у мышей, получавших аналоги витамина D 3 , чем у контрольных мышей (таблица 4). Соединения KH 1060, Ro 27-5646 и EB1089 были наиболее эффективными при стимуляции роста волос. 1,25 (OH) 2 D 3 мало влиял на рост волос (таблица 4, рис.4). Время достижения максимального роста волос варьировалось в группах лечения витамином D 3 . Например, латентный период составлял в среднем 9 дней для мышей, получавших группы Ro 27-0574 или EB1089 (самки), тогда как он составлял 18 дней для самцов, получавших EB1089, и 21 день для мышей, получавших KH 1060 (рис. ). Быстрая потеря волос довела показатели до исходного уровня в течение 4 дней, даже несмотря на то, что лечение аналогом витамина D 3 не было прекращено. Второй цикл роста волос (пиковая оценка 7–8) произошел в группах лечения Ro 25-9022, Ro 27-0574 и EB1089 примерно через 19 дней после первого цикла.Мы также исследовали способность EB1089 стимулировать рост волос у самцов и самок мышей. У обоих была стимуляция волос; первый пик роста волос у женщин немного предшествовал пику у мужчин (рис. 4F).

Таблица 4.

Сводная информация о наивысших показателях волосяного покрова, полученных у голых мышей, получавших витамин D 3 аналогов

0,00
. Контроль . 1,25 (ОН) 2 D 3 . Ro 25-9022 . KH 1060 . Ro 27-0574 . Ro 27-5646 . EB1089 .
Мужской . Женский .
Наивысший балл 5 5 8 8 8 8 7 7
5 7 8 7
3 4 8 6 8 6 4 7 Среднее значение00 4,67 7,67 6,67 7,00 7,00 6,33 7,00
sd 1,00
P значение 0,37 0,01 0,04 0,06 0,02 0,16 0.01
0,00
. Контроль . 1,25 (ОН) 2 D 3 . Ro 25-9022 . KH 1060 . Ro 27-0574 . Ro 27-5646 . EB1089 .
Мужской . Женский .
Наивысший балл 5 5 8 8 8 8 7 7
5 7 8 7
3 4 8 6 8 6 4 7 Среднее значение00 4,67 7,67 6,67 7,00 7,00 6,33 7,00
sd 1,00
P значение 0,37 0,01 0,04 0,06 0,02 0,16 0.01
Таблица 4.

Сводные данные о наивысших показателях волосяного покрова, достигнутых голыми мышами, получавшими витамин D 3 аналогов

0,00
. Контроль . 1,25 (ОН) 2 D 3 . Ro 25-9022 . KH 1060 . Ro 27-0574 . Ro 27-5646 . EB1089 .
Мужской . Женский .
Наивысший балл 5 5 8 8 8 8 7 7
5 7 8 7
3 4 8 6 8 6 4 7 Среднее значение00 4,67 7,67 6,67 7,00 7,00 6,33 7,00
sd 1,00
P значение 0,37 0,01 0,04 0,06 0,02 0,16 0.01
0,00
. Контроль . 1,25 (ОН) 2 D 3 . Ro 25-9022 . KH 1060 . Ro 27-0574 . Ro 27-5646 . EB1089 .
Мужской . Женский .
Наивысший балл 5 5 8 8 8 8 7 7
5 7 8 7
3 4 8 6 8 6 4 7 Среднее значение00 4,67 7,67 6,67 7,00 7,00 6,33 7,00
sd 1,00
P значение 0,37 0,01 0,04 0,06 0,02 0,16 0.01

РНК и белок были экстрагированы из одних и тех же образцов кожи с наивысшим баллом около 8 у мышей, получавших EB1089 и Ro 25-9022, и у мышей, получавших 1,25 (OH) 2 D 3 или контроль разбавителя. КДНК была сделана и амплифицирована для экспрессии кератиновых генов. Экспрессия мРНК кератина дифференциально регулировалась в коже животных, получавших аналог витамина D 3 (фиг. 5). 1,25 (OH) 2 D 3 увеличивал экспрессию мРНК Ha1, но не влиял на уровни каких-либо других исследованных кератинов (рис.5, А и Б). Кожа мышей, получавших EB1089 или Ro 25-9022, показала значительно повышенную экспрессию мРНК ( P <0,05) кератинов Ha1, Ha7, Ha8 и Hb3. Экспрессия На4 значимо не увеличивалась ни при каком лечении. Экспрессию кератинов Hb3 и Ha8 определяли на уровне белка с помощью вестерн-блоттинга (рис. 6). В соответствии с результатами ПЦР уровни Hb3 и Ha8 были увеличены в коже мышей, обработанных Ro 25-9022 и EB 1089, но не обработанных 1,25 (OH) 2 D 3 .

Рисунок 5.

A, Влияние витамина D 3 аналогов на экспрессию мРНК кератина в коже голых мышей. A, RT-PCR анализ РНК, полученной из кожи мышей, обработанных либо контрольным разбавителем, 1,25 (OH) 2 D 3 , либо аналогами витамина D 3 . КДНК с обратной транскрипцией амплифицировали с помощью ПЦР с использованием наборов праймеров, специфичных для кератинов, для 35 циклов или 18S РНК для 25 циклов. В. Цифровое количественное определение сигналов для пяти кератинов, как показано на А.Относительная экспрессия кератина определяется путем нормализации до уровней 18S РНК. Результаты представлены в виде процента экспрессии по сравнению с контрольными мышами. *, P <0,05.

Рисунок 5.

A, Влияние витамина D 3 аналогов на экспрессию мРНК кератина в коже голых мышей. A, RT-PCR анализ РНК, полученной из кожи мышей, обработанных либо контрольным разбавителем, 1,25 (OH) 2 D 3 , либо аналогами витамина D 3 .КДНК с обратной транскрипцией амплифицировали с помощью ПЦР с использованием наборов праймеров, специфичных для кератинов, для 35 циклов или 18S РНК для 25 циклов. B. Цифровое количественное определение сигналов для пяти кератинов, как показано на рисунке A. Относительная экспрессия кератина определяется путем нормализации до уровней 18S РНК. Результаты представлены в виде процента экспрессии по сравнению с контрольными мышами. *, P <0,05.

Рисунок 6.

Влияние аналогов витамина D 3 на экспрессию белков кератина волос.Вестерн-блоттинг зондировали последовательно антисыворотками против Hb3 и Ha8, а также глицеральдегид-3-фосфатдегидрогеназой (контроль нагрузки).

Рис. 6.

Влияние аналогов витамина D 3 на экспрессию белков кератина волос. Вестерн-блоттинг зондировали последовательно антисыворотками против Hb3 и Ha8, а также глицеральдегид-3-фосфатдегидрогеназой (контроль нагрузки).

Чтобы выяснить, является ли эффект стимуляции роста волос с помощью аналогов витамина D 3 специфическим для голых мышей, мышам C57 BL / 6 давали либо Ro 25-9022, либо Ro 26-9114 три раза в неделю после возобновления роста волос. стимулировался выщипыванием волос.Оценка волос производилась три раза в неделю с использованием той же шкалы, которая описана в таблице 1. Во время лечения любым из аналогов витамина D 3 не наблюдалось ускорения роста волос (фиг. 7).

Рисунок 7.

Влияние аналогов витамина D 3 на индукцию образования новых волос после выщипывания волос у мышей C57 BL / 6. Мыши C57 BL / 6 получали контрольный разбавитель Ro 26-9114 или Ro 25-9022 три раза в неделю со дня выщипывания волос.Оценка волос производилась три раза в неделю. Каждый символ представляет собой среднее значение ± стандартное отклонение от восьми мышей.

Рисунок 7.

Влияние аналогов витамина D 3 на индукцию образования новых волос после выщипывания волос у мышей C57 BL / 6. Мыши C57 BL / 6 получали контрольный разбавитель Ro 26-9114 или Ro 25-9022 три раза в неделю со дня выщипывания волос. Оценка волос производилась три раза в неделю. Каждый символ представляет собой среднее значение ± стандартное отклонение от восьми мышей.

Обсуждение

Волосяные фолликулы непрерывно проходят три фазы (см.18): фаза роста (анаген), стадия инволюции (катаген) и период покоя (телоген). Молекулярные сигналы, которые контролируют переход фолликулов между этими стадиями, до конца не изучены. На рост волос влияют различные гормоны, в том числе эстроген, гормон роста и андрогены (19, 20). Андрогены могут способствовать миниатюризации фолликулов и сокращению продолжительности стадии анагена. Напротив, эстроген может продлить стадию анагена.

Стимуляция роста волос — это так называемый Святой Грааль, к которому стремятся многие ученые, особенно в фармацевтических компаниях.На рынке представлено несколько препаратов, стимулирующих рост волос, в том числе миноксидил и финастерид (21, 22). Миноксидил продлевает стадию анагена роста волос и вызывает увеличение и рост фолликулов в состоянии покоя. Он удлиняет и увеличивает мелкие пушковые волоски и уменьшает выпадение волос (21). Как он опосредует эти эффекты, неясно. Финастерид представляет собой ингибитор 5-α редуктазы 2 типа, который снижает уровень дигидротестостерона в сыворотке и коже и, следовательно, ингибирует андроген-зависимую миниатюризацию волосяных фолликулов (22).

Мыши с нокаутом рецептора витамина D характеризуются 1,25 (OH) 2 D 3 -резистентным рахитом с гипокальциемией, гипофосфатемией, гиперпаратиреозом, рахитом, остеомаляцией и алопецией (6, 23, 24). Перевод этих животных на диету с высоким содержанием кальция, фосфора и лактозы может нормализовать их фенотип, за исключением алопеции (23, 25). Кроме того, у лиц с устойчивым к витамину D 3 рахит типа 2 имеет инактивирующую зародышевую линию мутацию VDR с частичной или полной алопецией (26).Исследования с использованием мышей с нокаутом VDR показали, что кератиноциты являются аберрантными клетками, ответственными за их фенотип без шерсти (23, 27). Кератиноциты экспрессируют Whn, и анализы восстановления волос показали, что они являются дефектным типом клеток в развитии волос у мышей nude (2). Исследования показали, что экспрессия нескольких генов кератина снижена в голой коже и что транскрипция гена кератина может регулироваться Whn (4, 28). В наших исследованиях мы показали, что лечение голых мышей аналогами витамина D 3 увеличивало экспрессию кератинов в их коже одновременно с ростом волос.Эти наблюдения предполагают, что аналоги витамина D 3 действуют временно, нормализуя кератиноциты голых мышей, что позволяет производить волосы.

Выщипывание волос вызывает начало новой фазы анагена волосяного фолликула. Наши эксперименты с использованием мышей C57 BL / 6 показали, что аналоги витамина D 3 не влияли на повторное появление волос после выщипывания. Это наблюдение предполагает, что аналоги витамина D 3 не влияют на индукцию анагена. Аналоги витамина D 3 , по-видимому, действуют ниже Whn, о чем свидетельствует их способность увеличивать экспрессию мРНК генов-мишеней Whn, кератина Ha1, Ha7, Ha8 и Hb3, в коже голых мышей.Ранее было показано, что 1,25 (OH) 2 D 3 активирует экспрессию кератина во время дифференцировки кератиноцитов (29), хотя этот эффект был косвенным (30). В кератиноцитах Whn экспрессируется на ранних стадиях терминальной дифференцировки, где он активирует маркеры ранней дифференцировки, такие как кератин 1 (4, 31). Наши наблюдения на голых мышах показывают, что лечение аналогами витамина D 3 способно преодолеть блокировку дифференцировки кератиноцитов, вызванную инактивацией Whn, что приводит к увеличению экспрессии кератина и образованию видимых волос.

Недавнее исследование продемонстрировало, что у пациента с мутировавшим VDR алопеция была неотличима от атрихии, вызванной мутациями в гене бесшерстности (32). Авторы пришли к выводу, что VDR и ген безволосости могут быть частью одного и того же или конвергентного генетического пути, необходимого для нормального цикла волос. У голых мышей аберрантный фенотип вызван дефектом катагена (33). Это повышает вероятность того, что аналоги витамина D 3 могут регулировать экспрессию генов, контролирующих катаген.

В наших экспериментах введение 1,25 (OH) 2 D 3 не вызывало роста волос у мышей nude; однако различные аналоги витамина D 3 действительно вызывали рост волос. Ранее было показано, что все эти аналоги обладают большей способностью вызывать дифференцировку и ингибировать пролиферацию различных типов клеток, связанных с раком, как in vitro, , так и in vivo (10-15) (Таблица 3). Следовательно, вероятная причина, по которой аналоги витамина D 3 способны стимулировать рост волос у голых мышей, тогда как 1,25 (OH) 2 D 3 не могут, заключается в том, что они обладают большей эффективностью in vivo .Каждый из аналогов способен связываться с VDR (9). Некоторые из механизмов, которые, как предполагается, объясняют их повышенную эффективность, включают тот факт, что они уменьшили связывание с D-связывающим белком в сыворотке, что обеспечивает более легкий доступ к проникновению в клетку. Эти аналоги могут изменять конформацию VDR, делая их более активными, или они могут увеличивать период полужизни активированного VDR (34). Они также могут модулировать способность корепрессоров или соактиваторов взаимодействовать с лиганд-активированным VDR (35).Каким бы ни был механизм, эти аналоги действуют на волосяной фолликул голых мышей, вероятно, за счет стимуляции экспрессии генов, таких как кератины, которые находятся ниже по течению от дефектного фактора транскрипции Whn; и эти гены имеют решающее значение для формирования стержня волоса (16, 17, 31). Таким образом, наши результаты убедительно доказывают, что аналоги витамина D 3 могут стимулировать рост волос у голых мышей, у которых обычно нет видимых волос.

Благодарности

Эта работа была частично поддержана семейным фондом Сида и Энн Шварц, Horn Trust и Parker Hughes Foundation.H.P.K. является заведующим кафедрой онкологии Марка Гудсона в медицинском центре Cedars Sinai и членом онкологического центра Йонссона.

Сокращения

  • BNX

  • 125 (OH) 2 D 3

  • VDR

1

Nehls

M

,

Pfeifer

Hedrich

H

,

Boehm

T

1994

Новый член семейства белков winged-helix, разрушенный при мутациях nude у мышей и крыс

.

Nature

372

:

103

107

2

Brissette

JL

,

Li

J

,

Kamimura

J

,

Lee

GP

1996

Продукт голого локуса мыши, Whn, регулирует баланс между ростом и дифференцировкой эпителиальных клеток

.

Genes Dev

10

:

2212

2221

3

Франк

J

,

Pignata

C

,

Пантелеев

AA

,

H DM

Prowse

,

Weiner

L

,

Gaetaniello

L

,

Ahmad

W

,

Pozzi

N

,

Cserhalmi-Friedman

PB

a H

,

Gordon

D

,

Ott

J

,

Brissette

JL

,

Christiano

AM

1999

Выявление фенотипа человеческого обнаженного тела

.

Nature

398

:

473

441

4

Schorpp

M

,

Schlake

T

,

Kreamalmeyer

D

000

Allen

2000

Генетически разделимые детерминанты экспрессии гена кератина волос

.

Dev Dyn

218

:

537

543

5

Schlake

T

,

Schorpp

M

,

Nehls

M

Boeh Ген nude кодирует специфичный для последовательности ДНК-связывающий белок с гомологами у организмов, у которых отсутствует упреждающая иммунная система

.

Proc Natl Acad Sci USA

94

:

3842

3847

6

Yoshizawa

T

,

Handa

Y

,

Uematsu

Y

a

K

,

Yoshihara

Y

,

Kawakami

T

,

Arioka

K

,

Sato

H

,

Uchiyama

000 Yukiyama

000 Ychiyama

A

,

Matsumoto

T

,

Kato

S

1997

Мыши, лишенные рецептора витамина D, после отлучения от

демонстрируют нарушение костеобразования, гипоплазию матки и задержку роста.

Nat Genet

16

:

391

396

7

Reichrath

J

,

Schilli

M

,

Kerber

A 9000 C00030003

Bahmer 9000

,

Paus

R

1994

Экспрессия 1,25-дигидроксивитмина в волосяных фолликулах рецепторов D 3 во время цикла волос мышей

.

Br J Dermatol

131

:

477

482

8

Bikle

DD

,

Gee

E

,

Pillai

S

Регулирование роста и дифференциации 1993 года Метаболизм витамина D аналогами 1,25-дигидроксивитамина D3

.

J Invest Dermatol

101

:

713

718

9

Бульон

R

,

Okamura

WH

,

Norman

функция A

Взаимосвязи между витамином 1995 Эндокринная система D

.

Endocr Ред.

16

:

200

257

10

Hisatake

J

,

O’Kelly

J

,

Uskokovic

M

u

,

Koto3ffler

HP

2001

Новый витамин D 3 аналог, 21- (3-метил-3-гидроксибутил) -19-нор-D 3 , который модулирует рост клеток, дифференцировку, апоптоз, клеточный цикл , и индукция PTEN в лейкозных клетках

.

Кровь

97

:

2427

2433

11

Шиохара

M

,

Ускокович

M

,

Хисатаке

J

,

000

000 Хисатаке ,

Komiyama

A

,

Koeffler

HP

2001

24-оксо метаболиты аналогов витамина D3: устранение их выраженных антилейкемических эффектов из-за отсутствия модуляции кальция

.

Cancer Res

61

:

3361

3368

12

Lee

YY

,

Kim

ES

,

Seol

JG

,

BIM

up

Elstner

E

,

Park

DJ

,

Koeffler

HP

1996

Влияние аналога витамина D 3 , EB1089, на гемопоэтические стволовые клетки

миелоцитов

Лейкемия

10

:

1751

1757

13

Elstner

E

,

Linker-Israel

M

,

Саид

J

,

Umiel

S

,

Shintaku

IP

,

Heber

D

,

Binderup

L

,

Uskokovic

M

,

Koeffler

EP

3 аналога : новый класс сильнодействующих ингибиторов пролиферации и индукторов дифференцировки линий клеток рака молочной железы человека

.

Cancer Res

55

:

2822

2830

14

Koike

M

,

Koshisuzuka

K

,

Sawabata

H

000

, Y

,

Said

J

,

Uskokovic

M

,

Tsuruoka

N

,

Koeffler

HP

1999

Аналоговый витамин D-Cyclopropyl-909

мощные ингибиторы пролиферации клеточных линий простаты, груди и миелоидного лейкоза человека

.

Anticancer Res

19

:

1689

1698

15

Kubota

T

,

Koshizuka

K

,

Koike

M

hi

000

M

,

Koeffler

HP

1998

19-нор-26, 27-бисомовитамин D 3 аналогов: уникальный класс мощных ингибиторов пролиферации раковых клеток простаты, груди и кроветворных клеток

.

Cancer Res

58

:

3370

3375

16

Rogers

MA

,

Winter

H

,

Wolf

C

,

Heck

M

1998

Характеристика парного домена из 190 килобаз генов кератина волос типа I человека

.

J Biol Chem

273

:

26683

26691

17

Langbein

L

,

Rogers

MA

,

Winter

H

,

H Praetzel

J

2001

Каталог кератинов человеческого волоса.II. Экспрессия шести членов типа II в волосяном фолликуле и объединенный каталог человеческих кератинов I и II типа

.

J Biol Chem

276

:

35123

35132

18

Fuchs

E

,

Merrill

BJ

,

Jamptora

C

,

В основе нескончаемого цикла

.

Dev Cell

1

:

13

25

19

Sawaya

ME

,

Penneys

NS

1992

Иммуногистохимическое распределение ароматазы фолиевой кислоты человека и волосяной деформации 3B сальник

.

J Cutan Pathol

19

:

309

314

20

Hodgins

MB

,

Murad

S

1986

25-дигидрооксиэстинэстинэстиновый холестерин в коже человека стимулирует превращение 25-дигидро-оксихолекулярных фибробластов в кожу человека культура

.

J Эндокринол

110

:

R1

R4

21

DuCharme

DW

,

Freyburger

WA

,

Graham

000

000 R7

000

BE

000

Свойства миноксидила: новое гипотензивное средство

.

J Pharmacol Exp Ther

184

:

662

670

22

McClellan

KJ

,

Markham

A

1999

Finasteride анализ облысения при выпадении волос у мужчин. .

Наркотики

57

:

111

126

23

Sakai

Y

,

Kishimoto

J

,

Demay

MB

2001

клеточный анализ метаболизма

9000 рецепторы мышей с нокаутом

.

J Clin Invest

107

:

961

966

24

Li

YC

,

Pirro

AE

,

Amling

M

,

9000 Barber

R

,

Bronson

R

,

Demay

MB

1997

Целевое удаление рецептора витамина D: животная модель витамин D-зависимого рахита II типа с алопецией

.

Proc Natl Acad Sci USA

94

:

9831

9835

25

Li

YC

,

Amling

M

,

Pirro

AE

000 M

000 M

000 M

J

,

Baron

R

,

Delling

G

,

Demay

MB

1998

Нормализация гомеостаза минеральных ионов с помощью диетических средств предотвращает гиперпаралопеидизм, ахиторию и рак Мыши с удаленными рецепторами витамина D

.

Эндокринология

139

:

4391

4396

26

Hewison

M

,

O’Riordan

JLH

1994

Устойчивость к витамину D

.

Baillieres Clin Endocrinol Metab

9

:

305

315

27

Chen

CH

,

Sakai

Y

,

Demay

MB

2001

Экспрессия витамина человека

Рецептор D кератиноцитов мышей с нулевым рецептором витамина D предотвращает алопецию

.

Эндокринология

142

:

5386

5392

28

Schlake

T

,

Schorpp

M

,

Maul-Pavicic

A

000

000

000

000 AM

000

000

000 AM

000

T

2000

Фактор транскрипции «вилка / крылатая спираль» Whn регулирует экспрессию гена кератина волос: молекулярный анализ фенотипа «голой» кожи

.

Dev Dyn

217

:

368

376

29

Hosomi

J

,

Hosoi

J

,

Abe

E

,

000 T

Suda

000

1983

Регуляция терминальной дифференцировки культивируемых эпидермальных клеток мыши с помощью 1,25-дигидроксивитамина D3

.

Эндокринология

113

:

1950

1957

30

Блюменберг

M

,

Коннолли

DM

,

Freedberg

IW

Регулирование экспрессии гена IW

Роль ядерных рецепторов гормонов ретиноевой кислоты, гормона щитовидной железы и витамина D3

.

J Invest Dermatol

98

:

42

S – 49S31

Baxter

RM

,

Brissette

JL

2002

Роль голого гена в терминальной дифференцировке эпителия

.

J Invest Dermatol

118

:

303

309

32

Миллер

J

,

Джабали

K

,

Чен

ред Т

000

000 Liu

000

Liu

M

,

Lyle

S

,

Christiano

AM

,

Holick

M

,

Cotsarelis

G

2001

Атрихия, вызванная мутациями в гене генерализованного фенокартона D. atrichia, вызванные мутациями в гене безволосого

.

J Invest Dermatol

117

:

612

617

33

Пантелеев

AA

,

Бочкарева

NV

,

Sundberg

JP

Paus

R

1999

Роль гена безволосого (hr) в регуляции катагеновой трансформации волосяного фолликула

.

Am J Pathol

155

:

159

171

34

Van den Bemd

GC

,

Pols

HA

,

Birkenhager

en JC

,

,

1996

Изменение конформации и усиленная стабилизация рецептора витамина D с помощью аналога 1,25-дигидроксивитамина D3 KH 1060

.

Proc Natl Acad Sci USA

93

:

10685

10690

35

Campbell

MJ

,

Koeffler

HP

1997

На пути к терапевтическому вмешательству витаминов D.

J Национальное онкологическое учреждение

89

:

182

186

Авторские права © 2002, Общество эндокринологов

Сделайте ваши волосы быстрее с помощью этих 9 витаминов и минералов, потому что здоровые пряди исходят от здорового человека

Итак, вы хотите отрастить более длинные волосы.Несмотря на то, что в основном это просто игра на ожидание, на самом деле есть несколько вещей, которые вы можете сделать, чтобы ваши волосы росли с максимально возможной скоростью. Конечно, нужно регулярно подстригать, чтобы секущиеся кончики не выглядели так, как будто они не растут. Вы также можете попытаться ограничить вредные привычки, такие как химическая обработка, тепловая укладка и даже плетение волос. Но иногда наибольшую помощь может оказать что-то более простое — ваше здоровье.

Если желаемая длина не получается, обратите внимание на ежедневное потребление витаминов и минералов.Относительно здоровая диета играет важную роль в росте здоровых волос, поскольку эти питательные вещества так же полезны для ваших волос, как и для всего тела. Но если вы чувствуете, что просто не получаете все необходимое, попробуйте включить поливитамины или индивидуальные витаминные добавки в свой ежедневный рацион. Это поможет сделать волосы более длинными и крепкими. Если вы предпочитаете идти естественным путем, вот некоторые из самых важных витаминов и минералов для роста волос, а также продукты, в которых они есть.

Витамин A

Дэн Китвуд / Getty Images News / Getty Images

Витамин A необходим для роста клеток. Он также способствует выработке здорового кожного сала в коже головы, что предотвращает высыхание прядей. Его можно найти во фруктах и ​​овощах, таких как дыня, персики, шпинат и морковь. Вот в чем дело, Док.

Биотин

Шон Гэллап / Getty Images News / Getty Images

Биотин не только увеличивает густоту волос, но и помогает производить больше волос.Его можно найти в таких продуктах, как коричневый рис, горох, чечевица и овес.

Витамин C

Sandra Mu / Getty Images News / Getty Images

Витамин C отвечает за выработку коллагена, который важен для укрепления волос и улучшения их роста. Его можно найти в таких фруктах, как черника, клубника, киви и апельсины.

Витамин D

Шон Гэллап / Getty Images News / Getty Images

Витамин D способствует здоровому росту фолликулов, уменьшая выпадение волос.Его особенно можно найти в молочных продуктах, таких как молоко, йогурт и сыр. Если вы не получаете достаточного количества витамина D из своего рациона, обязательно проводите около 10-15 минут на улице каждый день, так как вы также можете получить витамин D от солнца.

Витамин E

Джастин Салливан / Getty Images News / Getty Images

Витамин E может предотвратить выпадение волос, помогая сохранить здоровье кожи головы. Его можно найти в таких продуктах, как бобы, соевые бобы, листовая зелень и орехи.

Железо

Джастин Салливан / Getty Images News / Getty Images

Железо помогает клеткам, производящим волосы, работать изо всех сил, облегчая передачу кислорода клеткам.Его можно найти в таких продуктах, как красное мясо, птица и яйца.

Магний

Фил Уолтер / Getty Images News / Getty Images

Магний способствует здоровью кожи головы, созданию сильных и здоровых волос. Его можно найти в таких продуктах, как семена, орехи, лосось и дикий рис.

Ниацин

Скотт Олсон / Getty Images News / Getty Images

Ниацин питает кожу головы, способствуя кровообращению, что приводит к здоровому росту волос. Его можно найти в таких продуктах, как рыба, курица, свинина и арахис.

Цинк

Джо Рэдл / Getty Images News / Getty Images

Цинк восстанавливает поврежденные волосковые клетки, а также сохраняет сальные железы, окружающие фолликулы, в идеальной форме. Его можно найти в таких продуктах, как устрицы, красное мясо и крупы. Так что да, длинные и здоровые волосы могут быть волшебным образом восхитительны (хотя вам, вероятно, лучше выбрать что-то, в котором немного меньше сахара).

Изображения: ramonespelt / Fotolia; Getty Images (9)

Лучшие витамины для волос для естественного роста волос

Какие витамины необходимы для ухода за волосами?

Витамин C, витамины группы B, такие как биотин (витамин B7 или витамин H) и ниацин (витамин B3), необходимы для роста волос.Чтобы волосы оставались блестящими, здоровыми и обеспечивали волосы необходимыми питательными веществами, придерживайтесь сбалансированной диеты с этими главными витаминами для роста волос. Эти витамины способствуют здоровью волос и максимально возможному длинному, густому и быстрому росту волос.

Какие витамины нужны мужчинам для предотвращения облысения по мужскому типу?

Витамин от выпадения волос с морским комплексом, полученным из рыбных белков, а также витамин С, цинк и семена льна, которые помогают питать мужские волосы изнутри, помогают предотвратить выпадение волос и способствуют росту существующих волос.У мужчин андрогенный гормон дигидротестостерон (ДГТ) может вызвать облысение по мужскому типу, препятствуя росту волос, препятствуя доставке питательных веществ к волосяному фолликулу. Это может быть причиной облысения у мужчин. Мужчинам, которые видят, что их линия роста волос залысины, следует принимать витамины от выпадения волос, чтобы восполнить запас питательных веществ, необходимых для предотвращения выпадения волос и питания волосяных фолликулов изнутри.

Как биотин помогает волосам расти?

Биотин — это комплекс витаминов группы B, который иногда называют витамином B7 или витамином H.Ваше тело производит его в кишечнике, а также содержится в таких продуктах, как темно-зеленые листовые овощи, орехи и яичные желтки. Дефицит биотина может вызвать выпадение волос. Биотин способствует росту волос, обновляя уже растущие волосяные фолликулы. Добавки биотина в вашем рационе могут сделать волосы более густыми, густыми и здоровыми. Суточная доза 2 таблеток витаминных добавок Viviscal Extra Strength для роста волос женщин содержит всего 240 мкг. биотина (витамина B7), что составляет 80% от рекомендуемой дневной нормы для среднего взрослого человека.

Как витамин С делает волосы здоровыми?

Витамин C — водорастворимый витамин с антиоксидантными свойствами. Витамин С важен для производства необходимого белка, называемого коллагеном, который составляет около одной трети вашего тела, включая кожу, связки и волосы. Как антиоксидант, витамин С помогает защитить ткани организма от повреждений, которые свободные радикалы могут нанести. Свободные радикалы могут повредить волосы, делая их ломкими и слабыми. Сухие и секущиеся волосы из-за дефицита витамина С могут привести к их выпадению или чрезмерному выпадению.Ваша суточная доза в 2 таблетки добавки для роста волос Viviscal Extra Strength содержит 118 мг. витамина С, что почти вдвое превышает дневную норму для среднего взрослого. Для мужчин суточная доза в 2 таблетки добавки от выпадения волос Viviscal Man содержит в общей сложности 30 мг. витамина С, что составляет 100% от суточной нормы среднего взрослого.

Действительно ли добавки для волос Viviscal работают?

Клинически доказано, что витамины Viviscal для роста волос способствуют росту существующих волос, снабжая волосяные фолликулы необходимыми питательными веществами для питания волос.В недавнем клиническом исследовании у пользователей было статистически значимое изменение толщины и количества волос по сравнению с группой плацебо. Хотя скорость роста волос и потребности у каждого человека разные, если в вашем рационе отсутствуют необходимые питательные вещества, витамин для роста волос, такой как Viviscal, действительно помогает волосам расти длиннее, толще или быстрее. Независимо от того, ускоряют ли добавки для роста волос Viviscal рост волос, отрастают ли волосы длиннее или толще (в зависимости от человека), таблетки для роста волос Viviscal работают, поставляя ключевые питательные вещества в фолликул, продлевая фазу анагена (роста) цикла роста волос.

Необходимые витаминные добавки могут остановить ломкость волос

Волосы мужчин и женщин могут быть повреждены из-за возраста, гормональных изменений, повседневного стресса или чрезмерной укладки, а также ломкости или чрезмерного выпадения волос. Витамины от выпадения волос помогают поддерживать здоровье и ухоженность волос и кожи головы, обеспечивая необходимое питание. Это помогает поддерживать оптимальную среду для здорового роста волос и уменьшает повреждение и ломкость волос.

Каковы побочные эффекты витаминов для роста волос?

Большинство людей в большинстве случаев имеют минимальные побочные эффекты от витаминов для волос.Однако всегда рекомендуется внимательно проверять этикетки продуктов. Если у вас аллергия на рыбу или морепродукты, перед приемом таблеток, содержащих морские ингредиенты, проконсультируйтесь с врачом. У каждого человека разные толерантности. Если у вас есть какие-либо вопросы, проконсультируйтесь с врачом, прежде чем начинать принимать какие-либо витамины от выпадения волос или принимать другие добавки.

Смогут ли витамины для волос быстро вырастить волосы?

Поскольку витамины для волос питают рост волос изнутри тела, для достижения результатов может потребоваться 2–3 месяца, а для достижения максимального результата роста волос может потребоваться до 6 месяцев.

Питательные вещества, которые вы потребляете, попадают в кровоток и в конечном итоге питают волосяные фолликулы. Поскольку волосы не являются важной частью тела, они могут быть одной из последних частей, получающих питание от витаминных добавок. Однако, в отличие от лекарств или средств для местного лечения роста волос, волосы не выпадут сразу после прекращения приема витаминов, потому что рост волос стимулировался изнутри. Таким образом, использование витаминов для роста волос — это безмедикаментозный раствор для роста волос, который работает с естественными процессами питания вашего тела и вашим индивидуальным циклом роста волос.

Какие витамины способствуют росту волос?

Для роста волос обязательно соблюдайте сбалансированную диету с витамином C, биотином (например, витамином B7 или витамином H) и ниацином (витамином B3). Если вы не можете получить достаточное количество этих витаминов в своем рационе, возможно, вам потребуется принимать витаминные добавки для роста волос.

Недостаток питательных веществ, включая определенные витамины, минералы или белок, может повлиять на рост ваших волос. Добавки для роста волос Viviscal Extra Strength питают волосы изнутри и способствуют существующему росту волос с помощью витамина С, биотина, ниацина, цинка, железа и запатентованного морского комплекса Viviscal AminoMar®, который получен из основных морских белков и некоторых ингредиентов природного происхождения.Добавки Viviscal для естественного роста волос обеспечивают волосы жизненно важными питательными веществами, чтобы продлить фазу анагена (роста) цикла роста волос. Таблетки Viviscal Natural питают волосяные фолликулы в четыре этапа. Пользователи добавок Вивискал могут заметить разницу всего через 3-4 месяца.

Польза витамина С для кожи, волос и здоровья

В мире очень мало ингредиентов, которые так важны для нашего организма, как витамин С. Без питательных веществ, содержащихся в свежих фруктах, витаминных добавках и овощах, велика вероятность столкнуться с осложнениями со здоровьем.Наш дерматолог в Веллингтоне собирается погрузиться в некоторые из невероятных преимуществ витамина С для кожи, волос и здоровья, начав с того, что ответит на ваши наиболее часто задаваемые вопросы о витамине С и его преимуществах. Не занимайтесь самодиагностикой в ​​Интернете, обязательно посетите DCSI, и мы с радостью ответим на все вопросы, касающиеся дефицита витамина С.

Преимущества витамина C для здоровья и ухода за кожей

Многие люди часто задаются вопросом, полезен ли витамин C для кожи и ухода за ними. Ответ — ДА, в DCSI работают одни из лучших дерматологов по лечению прыщей в Палм-Бич, которые искренне верят, что витамин С является ключом к здоровому питанию.Одним из основных преимуществ витамина С является его способность предотвращать или лечить простуду, помогает быстрее заживать раны, а также восстанавливать повреждения, вызванные свободными радикалами, осветляя кожу и устраняя темные пятна. Это один из лучших витаминов для сияющей кожи, который должен быть включен в рацион каждого человека и в ежедневный уход за кожей.

Что витамин С делает для вашей кожи?

Польза витамина С для здоровья и кожи делает его важной частью повседневного ухода за кожей. Банки с витамином C:

  • Предотвращение воздействия солнечных лучей
  • Защита от гиперпигментации
  • Стимулирование выработки коллагена
  • Улучшение текстуры и качества кожи
  • Лечить солнечный ожог
  • Помощь в лечении экземы

Светиться?

Витамин С — лучший витамин для сияющего лица.Наш дерматолог из Делрей-Бич отмечает, что витамин С, как правило, безопасен и мягок, если включен в сыворотки с витамином С. Витамин C не требует строгих мер предосторожности и является одним из самых эффективных витаминов для сияющей кожи.

Преимущества витамина C для волос

Помимо невероятных преимуществ витамина C для здоровья и кожи, он также может иметь огромное влияние на ваши волосы. Польза витамина С для ваших волос обусловлена ​​необходимым свойством витамина, который создает белок, известный под более популярным термином, коллаген.Витамин С способствует здоровью волос, уменьшает их выпадение и улучшает их рост. Недостаток витамина С также может стать причиной сухости волос и секущихся кончиков.

Что витамин С делает для ваших волос?

Преимущества витамина С для волос — вот почему наш дерматолог из Бока-Ратон рекомендует включать его в свой рутинный уход за волосами. Он может:

  • Избавиться от перхоти
  • Предотвратить преждевременное поседение волос
  • Предотвратить выпадение волос
  • Предотвратить ослабление, ломкость и истончение волос

Как принимать витамин С

Есть много форм приема Витамин C, включая продукты питания, сыворотки, маски для лица, шампуни, витаминные добавки и многое другое, которые могут предоставить вам преимущества витамина C.Если вы решите чаще включать витамин С в свой рацион, обязательно включайте в свой рацион перец чили, брокколи, капусту, папайю, клубнику, манго, ананас, сладкий перец, апельсины, лимон, киви и шиповник. Существуют также добавки с витамином С, которые можно принимать внутрь, сыворотки с витамином С для включения в процедуры ухода за кожей, а также инъекции витамина С.

В DCSI мы рекомендуем включать витамин С в ежедневный уход за кожей с помощью сывороток, масок, капель или пудры. Чтобы узнать больше о поиске эффективного продукта с витамином С, который принесет пользу вашей коже, свяжитесь с нами сегодня.

Дерматологи DCSI могут помочь в лечении акне и различных дерматологических заболеваний в Южной Флориде. Мы любим знакомиться с новыми пациентами и гордимся тем, что обеспечиваем нашим клиентам лечение, необходимое для того, чтобы чувствовать себя лучше.

Дополнительная литература:

Пробудите вашу кожу на летнее время

Как перестать постоянно проверять наличие прыщей

Лучшие натуральные отшелушивающие средства

.

Добавить комментарий

Ваш адрес email не будет опубликован.